1000 people were asked their preferred method of exercise. The following table shows the results grouped by age.
18-22 23-27 28-32 33-37 total
Run 54 40 42 66 202
Bike 77 68 90 70 305
Swim 28 43 50 52 173
Other 90 78 71 81 320
Total 249 229 253 269 1000
You meet 25 yo who too the survey. What is the proba the she prefers biking?
please express your answer in the form of a fraction

Answers

Answer 1

The probability that a 25-year-old person from this group prefers biking is: 68/229.

How to determine the probability that a 25-year-old person from this group prefers biking

The total number of people in the survey between the ages of 23 and 27 is 229. The number of people who prefer biking in this group is 68.

Therefore, the probability that a 25-year-old person from this group prefers biking is: 68/229

To simplify the fraction, we can divide both the numerator and denominator by their greatest common factor (GCF), which is 1:

68/229 = 68/229

So the probability that a 25-year-old person from this group prefers biking is 68/229.

Learn more about probability at https://brainly.com/question/24756209

#SPJ1


Related Questions

an observer views the space shuttle from a distance of x = 2 mi from the launch pad.(a) Express the height of the space shuttle as a function of the angle of elevation θ. (b) Express the angle of elevation as a function of the height h of the space shuttle.

Answers

The angle of elevation is a function of the height of the space shuttle given by θ = arctan(h / 2).

Angle of elevation calculation.

(a) To express the height of the space shuttle as a function of the angle of elevation θ, we can use trigonometry. Let h be the height of the space shuttle above the launch pad. Then, we have:

tan(θ) = h / x

Solving for h, we get:

h = x * tan(θ)

Substituting x = 2 mi, we get:

h = 2 * tan(θ) mi

Therefore, the height of the space shuttle is a function of the angle of elevation θ given by h = 2 * tan(θ) mi.

(b) To express the angle of elevation as a function of the height h of the space shuttle, we rearrange the equation we found in part (a) as follows:

tan(θ) = h / x

tan(θ) = h / 2

Taking the inverse tangent of both sides, we get:

θ = arctan(h / 2)

Therefore, the angle of elevation is a function of the height of the space shuttle given by θ = arctan(h / 2).

Learn more about angle of elevation below.

https://brainly.com/question/88158

#SPJ1

The figure below shows a rectangle prism. One base of the prism is shaded

Answers

1. The volume of the prism is 144 cubic units

2. The area of the shaded base is 16units²

What is a prism?

A prism is a solid shape that is bound on all its sides by plane faces. A prism can have a rectangular base( rectangular prism) or a triangular base( triangular prism) or a circular base ( cylinder) e.t.c

Generally the volume of a prism is expressed as;

V = base area × height.

base area = l × w

therefore volume = l× w ×h

The base area = l× w

= 8× 2 = 16 square units

therefore the volume of the prism = 16 × 9

= 144 cubic units

Therefore the volume of the prism is 144 cubic units and the shaded base area is 16 units².

learn more about prisms from

https://brainly.com/question/23963432

#SPJ1

Help Evaluate function expressions

Answers

Thus,the solution of the expression for the given function f(x) and g(x) is found as: -1.f(-8) - 4.g(4) = -9.

Explain about the function:

A function connects an element x to with an element f(x) in another set, to use the language of set theory. The domain and range of the function are the set of values of f(x) that are produced by the values there in domain of the function, which is the set of values of x.

This indicates that a function f will map an object x to just one object f(x) in a set of potential outputs if the object x is in the set of inputs known as the domain (called the codomain).The symbolism of a function machine, which accepts an object as its input and produces another entity as its output based on that input, makes the concept of a function simple to understand.

given expression:

-1.f(-8) - 4.g(4) =  ?

Get the value of f(-8) and g(4)  from the graph shown.

f(-8) = -4

g(4) = 3

Put the expression:

= -1.*(-4) - 4*3

= 4 - 13

= -9

Thus,the solution of the expression for the given function f(x) and g(x) is found as: -1.f(-8) - 4.g(4) = -9.

Know more about the function:

https://brainly.com/question/11624077

#SPJ1

How many lines can be
constructed through point P
that are perpendicular to AB?

Answers

Answer:

A. 2

Step-by-step explanation:

It would be a triangle. There's no other way unless you used a point in between a and b

evaluate the line integral, where c is the given curve. c xey dx, c is the arc of the curve x = ey from (1, 0) to (e9, 9)

Answers

The line integral ∫C xey dx on the arc of the curve x = ey from (1, 0) to (e^9, 9) is (1/3)(e^27 - 1).

How to evaluate the line integral on the given curve?

Hi! I'd be happy to help you evaluate the line integral on the given curve. To evaluate the line integral ∫C xey dx, where C is the arc of the curve x = ey from (1, 0) to (e^9, 9), follow these steps:

1. Parameterize the curve: Since x = ey, let y = t, so x = e^t. Thus, the parameterization of the curve is r(t) = (e^t, t), with t ranging from 0 to 9.

2. Compute the derivative of the parameterization: dr/dt = (de^t/dt, dt/dt) = (e^t, 1).

3. Substitute the parameterization into the integrand: xey = (e^t)(e^t) = e^(2t).

4. Compute the dot product of the integrand and dr/dt: (e^(2t)) * (e^t, 1) = e^(3t).

5. Integrate the dot product with respect to t from 0 to 9: ∫(e^(3t)) dt from t = 0 to t = 9.

6. Evaluate the integral: [1/3 * e^(3t)] from t = 0 to t = 9 = [1/3 * e^(27)] - [1/3 * e^0] = (1/3)(e^27 - 1).

So, the line integral ∫C xey dx on the arc of the curve x = ey from (1, 0) to (e^9, 9) is (1/3)(e^27 - 1).

Learn more about Line Integrals and Parametrization

brainly.com/question/31472762

#SPJ11

consider all 5 letter "words" made from the letters a through h. (recall, words are just strings of letters,not necessarily actual english words.)(a) how many of these words are there total?

Answers

There are a total of 32768 (8) 5-letter "words" made from the letters a through h when all possible combinations are considered.

Consider all 5-letter "words" made from the letters A through H. There are a total of 8 unique letters, and since repetition is allowed, you can form 8 different possibilities for each of the 5 positions in the word. To calculate the total number of these words, simply multiply the possibilities for each position: 8 * 8 * 8 * 8 * 8 = 32,768. So, there are 32,768 possible 5-letter "words" using the letters A through H.

Know more about combinations here:

https://brainly.com/question/19692242

#SPJ11

If the shaded region is 1/6 of the perimeter of the circle with 10cm of the radius then find the measure of the angle inscribed in the circle.

Answers

The measure of the inscribed angle is determined as 150⁰.

What is the perimeter of the circle?

The perimeter of the circle is calculated as follows;

P = 2πr

where;

r is the radius of the circle

P = 2π x 10 cm

P = 62.832 cm

The length of the shaded regions calculated as follows;

S = 1/6 x 62.832

S = 10.47 cm

The angle inscribed is calculated as follows;

θ/360 x 2πr = 10.47

2πrθ = 360 x 10.47

θ = ( 360 x 10.47 )/(2π x 10)

θ = 60⁰

angle at center = 360 - 60 = 300

inscribed angle = ¹/₂ x 300 (angle at center is twice angle at circumference)

inscribed angle = 150⁰

Learn more about inscribed angle here: https://brainly.com/question/3538263

#SPJ1

Use logarithmic differentiation to find the derivative of the function. y = (x^3 + 2)^2(x^4 + 4)^4

Answers

The derivative of the function y = (x^3 + 2)^2(x^4 + 4)^4 using logarithmic differentiation is: y' = 2(x^3 + 2)(x^4 + 4)^3[3x^2(x^4 + 4) + 8x(x^3 + 2)^2]

To use logarithmic differentiation, we take the natural logarithm of both sides of the equation and then differentiate with respect to x using the rules of logarithmic differentiation.

ln(y) = ln[(x^3 + 2)^2(x^4 + 4)^4]

Now, we use the product rule and chain rule to differentiate ln(y):

d/dx [ln(y)] = d/dx [2ln(x^3 + 2) + 4ln(x^4 + 4)]

Using the chain rule, we get:

d/dx [ln(y)] = 2(1/(x^3 + 2))(3x^2) + 4(1/(x^4 + 4))(4x^3)

Simplifying this expression, we get:

d/dx [ln(y)] = 6x^2/(x^3 + 2) + 16x^3/(x^4 + 4)

Finally, we use the fact that d/dx [ln(y)] = y'/y to solve for y':

y' = y(d/dx [ln(y)])

Substituting in the expression for d/dx [ln(y)], we get:

y' = (x^3 + 2)^2(x^4 + 4)^4 [6x^2/(x^3 + 2) + 16x^3/(x^4 + 4)]

Simplifying this expression, we get:

y' = 2(x^3 + 2)(x^4 + 4)^3[3x^2(x^4 + 4) + 8x(x^3 + 2)^2]

Learn more about derivatives here: brainly.com/question/25324584

#SPJ11

Match the word(s) with the descriptive phrase.
1. a polyhedron with two congruent faces that lie in parallel planes
2. the sum of the areas of the faces of a polyhedron
3. the faces of a prism that are not bases
4. the sum of the areas of the lateral faces
5. a solid with two congruent circular bases that lie in parallel planes
A. lateral area
. B. lateral faces
C. prism
D. surface area
E. cylinder

Answers

Answer:

Step-by-step explanation:

1. B. lateral faces

2. D. surface area

3. B. lateral faces

4. A. lateral area

5. E. cylinder

find the inflection point of the function. (hint: g ' ' ( 0 ) g′′(0) does not exist.) g ( x ) = 9 x | x |

Answers

The inflection point of g(x) = 9|x| is x = 0.

First, let's find the first derivative of g(x):

g'(x) = 9 |x| + 9x * d/dx(|x|)

g'(x) = 9 |x| + 9x * sign(x)

where sign(x) is the sign function, which equals -1 for x < 0, 0 for x = 0, and 1 for x > 0.

Now, let's find the second derivative of g(x):

g''(x) = 9 * d/dx(|x|) + 9 * sign(x) + 9x * d/dx(sign(x))

g''(x) = 0 + 9 * sign(x) + 9x * d/dx(sign(x))

The derivative of the sign function is not defined at x = 0, but we can use the definition of the derivative to find the left and right limits of g''(x) as x approaches 0:

g''(0-) = lim x→0- [g''(x)]

g''(0-) = lim x→0- [9 * (-1) + 9x * (-∞)]

g''(0-) = -∞

g''(0+) = lim x→0+ [g''(x)]

g''(0+) = lim x→0+ [9 * (1) + 9x * (∞)]

g''(0+) = ∞

Since the left and right limits of g''(x) as x approaches 0 are not equal, g''(0) does not exist, and g(x) does not have an inflection point. Instead, the function changes concavity at x = 0, which is a vertical point of inflection.

To know more about inflexion point, here

https://brainly.com/question/28639394

#SPJ4

pls help me i’m struggling!!

Answers

Answer: DC
Explanation: DC intersects the center of the circle, as a radius does, and it intersects half the circle, unlike a diameter (BD), which would fully intersect the center of a circle.

Edwin's soccer team has a tradition of going out for pizza after each game. Last week, the team ordered 2 medium pizzas and 4 large pizzas for a total of 56 slices. This week, the team ordered 3 medium pizzas and 3 large pizzas for a total of 54 slices.

Answers

The question isn’t specific
Buh I guess we are looking for the amount contained in a medium slice and a large slice
That will be done simultaneously
Represent medium pizzas with x and large pizzas with y
2x+4y=56–eq 1
3x+3y=54—eq 2
Using the elimination method
2x+4y=56–*3—eq 3
3x+3y=54—*2—eq 4
6x+12y=168—eq 5
6x+6y=108—eq 6
Subtract eq6 from eq 5
Resulting answer is
6y=60
Therefore,y=10
Substitution of y=10 into eq 1

2x+4y=56
2x+4(10)=56
2x+40=56
2x=56-40
2x=16
x=8

Medium pizzas contains 8 slices and large pizzas contains 10 slices

a tree grows in height by 21% per
year. it is 2m tall after one year.
After how many more years will the
tree be over 20m tall

Answers

Answer:

12.08 years

Step-by-step explanation:

to overcome this problem we will have to use the exponential growth formula A = P(1+r)^t

where a is the final amount

where p is the initial amount

where r is the rate per year

where t is the number of years

we can say

20= 2(1+0.21)^t

solve the equation for t

20/2 = 2(1.21)^t/2

10 = 1.21^t

take the log of both sides we get that

t = 12.08 years

a random variable x is normally distributed with µ = 185 and σ = 14. find the 72th percentile of the distribution. round your answer to the tenths place.

Answers

The 72nd percentile of the normally distributed random variable x is 196.788, rounded to the tenths place.

What is percentile?

Percentile is expressed as a percentage of the group that is equal to or lower than the individual in question.

The 72nd percentile of a normally distributed random variable x is calculated by using the formula z = (x - μ) / σ, where z is the z-score, μ is the mean of the data, and σ is the standard deviation of the data.

In this case, z = (x - 185) / 14.

To find the 72nd percentile, we have to use the z-score table to look up the z-score that corresponds to the desired percentile.

The z-score for the 72nd percentile is 0.842.

Plugging this back into our formula, we get

x = 185 + (0.842 * 14)

= 196.788.

Therefore, the 72nd percentile of the normally distributed random variable x is 196.788, rounded to the tenths place.

For more questions related to standard deviation

https://brainly.com/question/475676

#SPJ1

The 72nd percentile of the normally distributed random variable x is 196.788, rounded to the tenths place.

What is percentile?

Percentile is expressed as a percentage of the group that is equal to or lower than the individual in question.

The 72nd percentile of a normally distributed random variable x is calculated by using the formula z = (x - μ) / σ, where z is the z-score, μ is the mean of the data, and σ is the standard deviation of the data.

In this case, z = (x - 185) / 14.

To find the 72nd percentile, we have to use the z-score table to look up the z-score that corresponds to the desired percentile.

The z-score for the 72nd percentile is 0.842.

Plugging this back into our formula, we get

x = 185 + (0.842 * 14)

= 196.788.

Therefore, the 72nd percentile of the normally distributed random variable x is 196.788, rounded to the tenths place.

For more questions related to standard deviation

https://brainly.com/question/475676

#SPJ1

if a is a square matrix there exists a matrix b such that ab equals the identity matrix. T/F

Answers

True. This is a true statement known as the invertible matrix theorem. If a square matrix is invertible, then there exists a matrix b such that ab equals the identity matrix. However, not all square matrices are invertible.

True. If matrix A is a square matrix and has an inverse matrix B, then the product of A and B (AB) equals the identity matrix. In other words, if A is invertible, there exists a matrix B such that AB = BA = I, where I is the identity matrix. This is a true statement known as the invertible matrix theorem. If a square matrix is invertible, then there exists a matrix b such that ab equals the identity matrix. However, not all square matrices are invertible.
True. If matrix A is a square matrix and has an inverse matrix B, then the product of A and B (AB) equals the identity matrix. In other words, if A is invertible, there exists a matrix B such that AB = BA = I, where I is the identity matrix.

To learn more about matrix, click here:

brainly.com/question/28180105

#SPJ11

Chelsea has 2. 24 pounds of meat. She uses 0. 16 pound of meat to make one hamburger. How many hamburgers can Chelsea make with the meat she has?

Answers

Answer:

14 hamburgers

Step-by-step explanation:

The problem uses division, but we can create a proportion to see how the division works.

Since we know that Chelsea can make 1 hamburger with 0.16 pounds and allow x to represent the number of burgers Chelsea can make with 2.24 lbs of meat, we have:

[tex]\frac{2.24}{x}=\frac{0.16}{1}[/tex]

[tex]2.24=0.16x[/tex]

As the proportion shows, we can divide 2.24 by 0.16 to get x = 14.

Check: 0.16 lbs * 14 patties = 2.24 lbs

determine the identity to (1 - (sin(x) - cos(x))^2)/(2 cos(x))a. tan (x) b. cos (x)c. sec (a)d. sin(x) e. none of these

Answers

The identity is (d) sin(x).

We can start by expanding the numerator:

(1 - (sin(x) - cos(x))^2) = 1 - (sin^2(x) - 2sin(x)cos(x) + cos^2(x))

= 1 - (1 - sin(2x))

= sin(2x)

Therefore, the expression simplifies to:

sin(2x)/(2cos(x))

Using the double angle formula for sine, sin(2x) = 2sin(x)cos(x), we get:

2sin(x)cos(x)/(2cos(x)) = sin(x)

So the identity is (d) sin(x).

To learn more about expression visit:

https://brainly.com/question/14083225

#SPJ11

for what values of b are the given vectors orthogonal? (enter your answers as a comma-separated list.) −11, b, 2 , b, b2, b

Answers

The given vectors are:
Vector A = (-11, b, 2)
Vector B = (b, b^2, b)

The values of b for which the given vectors are orthogonal are 0, -3, and 3.

Dot product:


To find the values of b for which the given vectors are orthogonal, we need to use the dot product of the vectors.

To determine if two vectors are orthogonal, their dot product should be equal to zero.

The dot product is calculated as follows:

Dot Product (A, B) = A1 * B1 + A2 * B2 + A3 * B3

Substituting the components of Vector A and Vector B:

(-11 * b) + (b * b^2) + (2 * b) = 0

Now, simplify the equation:

-11b + b^3 + 2b = 0
b^3 - 9b = 0

Factor the equation:

b(b^2 - 9) = 0

Now, we can find the values of b:

b = 0
b^2 - 9 = 0
b^2 = 9
b = ±3

So, the values of b for which the given vectors are orthogonal are 0, -3, and 3.

To know more about Dot product:

https://brainly.com/question/29097076

#SPJ11

The figure shows the dimensions of the cube-shaped box Amy uses to hold her
rings. What is the surface area of Amy's box?
A 1030.3 square centimeters
B 612.06 square centimeters
C 600 square centimeters
D 408.04 square centimeters

Answers

The surface area of Amy's box which is cube has is 294 square cm.

The surface area of a cube is given by the formula:

SA = 6s²

where s is the length of a side of the cube.

From the given figure, we can see that the length of a side of the cube is 7 cm.

Substituting s = 7 into the formula, we get:

SA = 6(7²)

= 294 square cm

Therefore, the surface area of Amy's box is 294 square cm.

To learn more on Three dimensional figure click:

https://brainly.com/question/2400003

#SPJ1

The side length of cube-shaped box is 7 cm find the surface area?

Will give a lot of points

Arturo launches a toy rocket from a platform. The height of the rocket in feet is given
by h(t)=-16t² + 32t + 128 where t represents the time in seconds after launch.
What is the rocket's greatest height?

Answers

Arturo launches a toy rocket from a platform. The height of the rocket in feet is given, so the rocket's greatest height is 144 feet.

The greatest height of the rocket corresponds to the vertex of the parabolic function h(t) = -16t² + 32t + 128, which occurs at the time t = -b/(2a), where a = -16 and b = 32.

So, t = -b/(2a) = -32/(2*(-16)) = 1.

Therefore, the rocket's greatest height occurs after 1 second of launch. We can find the height by substituting t = 1 into the equation for h(t):

h(1) = -16(1)² + 32(1) + 128 = 144.

Therefore, the rocket's greatest height is 144 feet.

For more details regarding rocket, visit:

https://brainly.com/question/15061209

#SPJ1

Yolanda wants to replace the grass in this triangular section of her yard with mulch. A bag of mulch costs $4.85 and covers 3 square feet. Which of the following statements accurately describe this situation? Select all that apply.

Yolanda wants to replace the grass in this triangular section of her yard with mulch. A bag of mulch costs $4.85 and covers 3 square feet. Which of the following statements accurately describe this situation? Select all that apply.

Answers

Answer:

Step-by-step explanation:

for each positive integer n, let p(n) be the formula 12 22 ⋯ n2=n(n 1)(2n 1)6. write p(1). is p(1) true?

Answers

The formula for p(n) is not valid for n = 1.

How to find p(1) is true?

For each positive integer n, using the formula given, we can find p(1) by plugging in n = 1:

p(1) = 1(1-1)(2(1)-1)/6 = 0/6 = 0

So, according to the formula, p(1) is equal to 0.

However, we can see that this is not a true statement.

Because the product in the formula is defined as the product of the squares of the odd integers from 1 to n, and when n = 1, there is only one odd integer, which is 1.

Thus, p(1) should be equal to [tex]1^2 = 1.[/tex]

Therefore, the formula for p(n) is not valid for n = 1.

Learn more about positive integer

brainly.com/question/18380011

#SPJ11

help me by answering this math question!!! i’ll mark brainliest

Answers

Answer:

30

because 1=3 so each of them are 30

To warm up, Coach Hadley had his swim team swim twelve 5–meter long laps. It took the team 5 minutes to finish the warm up. How fast did the team swim in centimeters per second?

Answers

The team swam at a speed of 20 centimeters per second during their warm up.

First, let's convert the length of one lap from meters to centimeters:

5 meters = 500 centimeters

So, the team swam 12 laps of 500 centimeters each, for a total distance of:

12 laps × 500 centimeters/lap = 6000 centimeters

Next, let's convert the time from minutes to seconds:

5 minutes = 300 seconds

To find the speed in centimeters per second, we can divide the distance by the time:

speed = distance ÷ time = 6000 centimeters ÷ 300 seconds

simplifying, we get:

speed = 20 centimeters/second

Therefore, the team swam at a speed of 20 centimeters per second during their warm up.

To know more about distance here

https://brainly.com/question/26550516

#SPJ1

A couple of two-way radios were purchased from different stores. Two-way radio A can reach 6 miles in any direction. Two-way radio B can reach 12.88 kilometers in any direction.

Part A: How many square miles does two-way radio A cover? Use 3.14 for π and round to the nearest whole number. Show every step of your work. (3 points)

Part B: How many square kilometers does two-way radio B cover? Use 3.14 for π and round to the nearest whole number. Show every step of your work. (3 points)

Part C: If 1 mile = 1.61 kilometers, which two-way radio covers the larger area? Show every step of your work. (3 points)

Part D: Using the radius of each circle, determine the scale factor relationship between the radio coverages. (3 points)

Answers

A. Two-way radio A covers 113 square miles.

B. Rounded to the nearest whole number, two-way radio B covers 523 square kilometers.

C. Comparing the areas, we can see that radio B covers the larger area with 523 square kilometers.

D. The coverage area of radio B is approximately 1.33 times larger than the coverage area of radio A.

What is radius?

Radius is a term used in geometry to describe the distance from the center of a circle or sphere to any point on its circumference or surface, respectively. It is usually denoted by the letter "r" and is measured in units of length, such as inches, centimeters, or meters. The radius of a circle is half of its diameter, while the radius of a sphere is one-half of its diameter.

Part A:

The area covered by two-way radio A can be calculated using the formula for the area of a circle:

Area = π x radius²

Radius of radio A = 6 miles

Area = 3.14 x 6²

Area = 113.04 square miles

Rounded to the nearest whole number, two-way radio A covers 113 square miles.

Part B:

The area covered by two-way radio B can also be calculated using the same formula:

Area = π x radius²

Radius of radio B = 12.88 kilometers

Area = 3.14 x (12.88)²

Area = 523.14 square kilometers

Rounded to the nearest whole number, two-way radio B covers 523 square kilometers.

Part C:

To compare the areas covered by the two-way radios, we need to convert the area covered by radio A from square miles to square kilometers, using the conversion factor given:

1 mile = 1.61 kilometers

Therefore, 1 square mile = (1.61)² square kilometers

Area covered by radio A = 113 square miles

Area covered by radio A in square kilometers = 113 x (1.61)²

Area covered by radio A in square kilometers = 290.22 square kilometers

Comparing the areas, we can see that radio B covers the larger area with 523 square kilometers.

Part D:

To determine the scale factor relationship between the radio coverages, we can divide the radius of radio B by the radius of radio A:

Scale factor = radius of radio B / radius of radio A

Scale factor = 12.88 kilometers / 6 miles

Scale factor = 12.88 kilometers / 9.66 kilometers (since 1 mile = 1.61 kilometers)

Scale factor = 1.33

This means that the coverage area of radio B is approximately 1.33 times larger than the coverage area of radio A.

To learn more about distance from the given link

https://brainly.com/question/12356021

#SPJ1

how many arrangements of mathematics are there in which each consonant is adjacent to a vowel?

Answers

There are 1,152 arrangements of "MATHEMATICS" in which each consonant is adjacent to a vowel.

To find the number of arrangements of the word "MATHEMATICS" in which each consonant is adjacent to a vowel, we can treat the consonants (M, T, H, M, T, C, and S) and vowels (A, E, A, I) as separate groups and arrange them in a way that each group of consonants is next to a group of vowels

We have two groups of vowels (A and E, and A and I) and three groups of consonants (MTHM, TC, and S). We can arrange the two vowel groups in 2! = 2 ways, and then arrange the three consonant groups in 3! = 6 ways. Within each group, the letters can be arranged in a total of 4! = 24 ways for the MTHM group, 2! = 2 ways for the TC group, and 1 way for the S group.

Therefore, the total number of arrangements in which each consonant is adjacent to a vowel is:

2! x 6 x 24 x 2 x 1 = 1,152

Learn more about arrangements here

brainly.com/question/22260435

#SPJ4

You make a pudding for a dinner party and put it in the refrigerator at 5 P.M. (t — 0). Your refrigerator maintains a constant temperature Of 400. The pudding will be ready to serve when it cools to 450. When you put the pudding in the refrigerator you measure its temperature to be 1900, and when the first guest arrives at 6 P.M., you measure it again and get a temperature reading of 1000. Based on Newton's Law of Cooling, when is the earliest you can serve the pudding? 

Answers

The earliest time you can serve the pudding is t = (-ln(30)) / k.

Where k is the constant value.

We have,

To find the earliest time you can serve the pudding, we need to determine the time at which the temperature of the pudding reaches 450.

Using Newton's Law of Cooling, the equation for the temperature of the pudding at time t is given by:

[tex]T(t) = T_{ambient} + (T_{initial} - T_{ambient} \times e^{-kt}[/tex]

Where:

T(t) is the temperature of the pudding at time t,

T_ambient is the ambient temperature (400),

T_initial is the initial temperature of the pudding (1900),

k is the cooling constant,

t is the time.

To find the earliest time, we set T(t) equal to 450 and solve for t:

[tex]450 = 400 + (1900 - 400) \times e^{-kt}[/tex]

Simplifying the equation, we get:

[tex]e^{-kt} = (450 - 400) / (1900 - 400)\\e^{-kt} = 50 / 1500\\e^{-kt} = 1 / 30[/tex]

Taking the natural logarithm of both sides:

-ln(30) = -kt

Solving for t, we have:

t = (-ln(30)) / k

Without the specific value of the cooling constant k, we cannot determine the exact value of the earliest time to serve the pudding.

Thus,

The earliest time you can serve the pudding is t = (-ln(30)) / k.

Where k is the constant value.

Learn more about Newton's law of cooling here:

https://brainly.com/question/29207423

#SPJ12

Matt bought a collection of 1660 stamps. He needs to choose between an album with large pages and an album with small pages to hold his stamps. The number of stamps per page for both album sizes is shown in the table. How many of each type of page will Matt need to hold all 1660 stamps?

Answers

Answer:Martin has 2212 stamps.

Step-by-step explanation:

Given,

Total number of pages = 48,

Out of which first 20 pages each have 35 stamps in 5 rows,

So, the stamps in first 20 pages = 35 × 20 = 700,

Now, the remaining number of pages = 48 - 20 = 28,

Also, each remaining page has 54 stamps,

So, the total stamps contained by remaining pages = 54 × 28 = 1512,

Hence, total stamps = stamps in 20 pages + stamps in 28 pages

= 700 + 1512

= 2212

Step-by-step explanation:

The answer: Matt will need 69 small pages and 46 large pages

Explanation: just divide 1660 with 24 and with 36.

Session 3
(Calculator)
David just bought six more baseball cards. The new baseball cards represent 30% of
David's special edition baseball card collection.)
Number of Baseball Cards
6
++
0
+
25 30
+
50
+
75
?
+
100
What is the total number of cards in David's baseball card collection?
Enter your answer in the box.

Answers

Answer:

If the new baseball cards represent 30% of David's special edition baseball card collection, then the original collection represents 70%. Let's represent the total number of cards in David's collection with the variable x. Then we can set up the following equation:

6 = 0.3x

To solve for x, we can divide both sides by 0.3:

x = 6 ÷ 0.3 = 20

Therefore, the total number of cards in David's baseball card collection is 20.

what is the volume in cubic centimeters of a right rectangular prism with a length of 10 cm, a width of 8 cm, and a height of 6 cm

Answers

Answer:

The formula for the volume of a right rectangular prism is given by:

Volume = Length * Width * Height

Given that the length is 10 cm, the width is 8 cm, and the height is 6 cm, we can substitute these values into the formula:

Volume = 10 cm * 8 cm * 6 cm

Multiplying the values:

Volume = 480 cubic centimeters

So, the volume of the right rectangular prism is 480 cubic centimeters.

According to the question, we were asked What is the volume, in cubic centimeters, of a right rectangular prism that has a length of 10 centimeters, a width of 8 centimeters, and a height of 6 centimeters?

When you hear about a rectangular prism, just know that we are talking about a cuboid and we all know here that the volume of a cuboid is the same as the volume of a rectangular prism which is:

[tex]\text{Length} \times \text{width} \times \text{breadth}[/tex].

And in this case, we have the length as 10 cm, the width as 8 cm and the subsequent height of the prism as 6 cm.

Applying this variables into the given formula for obtaining the volume for a prism,

We have [tex]9\times6\times10 = 480 \ \text{cm}^3[/tex]

Therefore, the volume of the right rectangular prism is 480 cm³.

Other Questions
What happens to the cous cous when the boiling water is added? The five girls had their refreshments at thekitchen table, and it was while Rosie wasshowing the sisters her trick of swallowing peachslices without chewing (she chased each slippery crescent down with a swig of tea) that her father brought his empty teacup and untouched saucerto the sink and said, "Come on, Rosie, we'regoing home now.""Already?" asked Rosie."Work tomorrow," he said.He sounded irritated, and Rosie, puzzled, gulped one last yellow slice and stood up to go, whilethe sisters began protesting, as was their wont."We have to get up at five-thirty," he told them, going into the front room quickly, so that theydid not have their usual chance to hang onto his hands and plead for an extension of time.Seventeen Syllables,Hisaye YamamotoRead the excerpt. What is the conflict in this scene?Rosie wants to swallow peach slices whole, but her father does not approve of this.Rosies father wants his family to leave, while the Hayano sisters want them to stay.Rosies father wants her to go to work early tomorrow, while Rosie wants to go later.Rosie wants to leave, but the Hayano sisters want to watch her swallow peach slices. IRAC: Two colleagues decide to incorporate their Internet social networking business. They want complete control of the business, yet they need additional capital to expand the business. The two colleagues enter negotiations with eight friends willing to provide capital to the corporation. The friends agree that they will not be allowed to elect directions, but they want to make sure that they will receive a return on their investments by receiving payments from the corporation quarterly or semiannually. What securities with what rights should the corporation create to achieve the objectives of the friends and colleagues? For each security you create, sketch the rights of the holders. 3. what is the spring constant? k = 0.49 incorrect: your answer is incorrect. n/cm 4. what is the force of the spring 2 Aggregate production strategies are part of your _______________ planning.a. Long rangeb. Short rangec. Intermediate range Mammals have fur, they suckle their young and the young develop inside the mother. is it True or False decribe teh mechansims resonpitble for con-a induced hemagglucnation reaction answer fast pls Translate these descriptions into a numerical expression:Find the sum of 2 and 4, then multiply by 7.Divide 12 by 3, then multiply by 5 In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction B) decay c) radiation D) kinetic energy E) potential energy 16.5 ft tall giraffe casts a 12-ft. shadow. at the same time a zookeeper casts a 4-ft shadow how tall in feet is the zookeeper how many grams of na2co3 (fm 105.99) should be mixed with 5.00 g of nahco3 (fm 84.01) to produce 100 ml of buffer with ph 10.00? After plotting the voltage waveform, obtain a 0.2-mp expressions and generate plots for (t), p (t), and w (t) for i by capacitor. The voltage waveforms are given:(a) v_1(t) = 5r(t) - 5r(t 2) V (b) v_2(t) = 10u(-t) + 10u(t) - 5r(t-2) + 5r(t-4) V (c) v_3(t) = 15u(-t) + 15e^(-0.5t) u(t) V (d) v_4(t) = 150[1 - e^(-0.5t)] u(t) V angles of a triangle Are dichotomous keys purely a human invention? Explain. in galatians, paul uses ___________ as an example of one justified by faith. It is recommended to interview the HIS users to identify vital information to daily operation in contingency planning True False Which network topology is the most reliable and why?OA. Ring topology, because data flows in one direction from node tonode around the ringB. Star topology, because the server manages all network traffic inone location, making it convenientC. Bus topology, because on large networks it is easy to fix if a cablefails and all nodes lose connectionD. Fully connected mesh topology, because it provides a connectionfrom each node to every other node in the network A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose?