According to Clevette and colleagues, examples of unsafe, common disciplinary actions reviewed by boards of nursing include all of the following EXCEPT

Answers

Answer 1

Failure to implement safeguards to ensure patient confidentiality of patients protected health information aren't reviewed  by boards of nursing.

Who is a Nurse?

This is a healthcare professional who is involved in taking care of the patient so as to ensure quick recovery.

The nursing board deals with approval of nursing programs and also issues which may arise from direct relationship with the patient  such as abuse so as to ensure the best hands are in the job.

Read more about Nursing here https://brainly.com/question/6685374

#SPJ1


Related Questions

"Knowing how to do something is important but behaving professionally while practicing is essential." What does this means to you as it relates to their future career choices?​

Answers

alright i will explain this from my point of view,while you are doing something like such as working as a lawyer you must doing ur job without involving personal feeling

The sphincter that separates the stomach from the duodenum is the.

Answers

Answer:

The pyloric sphincter

The pyloric sphincter, which separates the stomach and duodenum, periodically opens to release small portions of acidic chyme 

Is weight lifting better than bodybuilding

Answers

weightlifting is much better than bodylifting. The goal of weightlifting training is to improve maximal strength in activities like the squat, bench press, and deadlift. Bodybuilding training is less focused with the amount of weight lifted and more concerned with maximizing muscular hypertrophy (growth).

What is difference between bodybuilding and weightlifting?

Bodybuilding and weightlifting produce diverse types of physiques. Weightlifters conduct a lot of bodybuilding-style routines, but they mostly focus on training with the heaviest weights possible for relatively low reps—triples (three reps), doubles (two repeats), and singles (one rep) (one all-out rep).

This method is intended to increase maximum strength, but it does not produce the same shapely, defined, and well-proportioned muscle that a proper bodybuilding practice does. Using moderate to heavy weight and greater repetitions (usually between eight and 15 reps), as well as a program that focuses on all of the major muscle groups and particular locations within these groups, resulting in this type of development.

For more information regarding weightlifting, visit:

https://brainly.com/question/19753744

#SPJ1

Brantley has recently become infected with hiv. he begins anti-infective drugs right away. easton delayed getting tested for hiv for three years because he did not have symptoms. he also begins anti-infective drugs, after two years of taking the medications it would be expected that

a. brantley would have higher t-cell levels and lower hiv levels than easton because the virus was not able to infect as many cells intially.
b. brantley wouldhave lower t-cell levels and lower hiv levels than easton because the virus was not able to infect as ma cells initially.
c. easton would have lower t-cell levels but the same hiv levels as barantley because they have been on the anti-infective drugs for the same amount of time.
d. easton would have higher t-cell levels but the same hiv levels as brantley because they have been on the anti-infective drugs for the same amount of time.

Answers

Easton would have lower t-cell levels but the same hiv levels as barantley because they have been on the anti-infective drugs for the same amount of time.  Thus, the correct option is C.

What is AIDS?

The human immunodeficiency virus (HIV) is a virus that targets the immune system of the body. AIDS can develop if HIV is not treated (acquired immunodeficiency syndrome).

When a person's CD4 count goes below a certain threshold, they are diagnosed with AIDS.

Helper T cells are essential for immune system function and get activated when antigens from disease-causing bacteria are encountered. Antigens are biological markers that distinguish bacteria and viruses from one another.

For more information regarding AIDS visit:

https://brainly.com/question/1372427

#SPJ1

All connective tissue is derived from an embryonic tissue known as.

Answers

Correct answer is Mesenchyme

An obese diabetic client has bilateral leg aching is to start a cardiac rehabilitation with an exercise program. using which exercise equipment will be most helpful to the client

Answers

Answer:

The stationary bicycle is the most appropriate training modality because it is a non-weight-bearing exercise. The time that the individual exercises on the stationary bicycle is increased with improved functional capacity. The other exercise equipment requires exercising while standing

Explanation:

11) A claim is sent electronically yo a clearinghouse for procesing, However, there is an error in the claim. What happens to that claim?

a. it is returned to the office
b.it is returned to the patient
c.it is sent to the insurance company
d.it is destoyed

Answers

Answer:

It is returned to the patient

Explanation:

Any where someone sends an application that's not destroyedThey first read then approve or disapprove.If disapproved they sends back for correction and is resent to the patient

Answer:

11) A claim is sent electronically yo a clearinghouse for procesing, However, there is an error in the claim. What happens to that claim?

a. it is returned to the office

b.it is returned to the patient

c.it is sent to the insurance company

d.it is destoyed

Explanation:

If Tina had reported new onset ear pain, what would have been the most useful finding to determine otitis media

Answers

Otitis media is an infection or inflammation of the middle ear. A cold, sore throat, or respiratory illness can all cause otitis media.

What is otitis media symptoms?

Swelling and redness arise suddenly as a result of a middle ear infection. Fluid and mucus become trapped inside the ear, resulting in a fever, ear discomfort, and hearing loss in the youngster.

High-dose amoxicillin (80 to 90 mg per kg per day) is the antibiotic of choice for treating acute otitis media in patients who are not allergic to penicillin.

For more information regarding otitis media, visit:

https://brainly.com/question/12993904

#SPJ1

which health care team member is a first responder when an emergency or mass casualty incident occurs

Answers

Answer:

Critical care nurseCritical care nurses are often considered emergency medical personnel that respond to emergency or MCIs. Firemen and police officers are first responders but are not members of the health care team. Unlicensed assistive personnel are not first responders.

Explanation:

According to the Centers for Disease Control and Prevention, only children and adolescents whose _____ is at or above the _____ percentile are classified as obese.

Answers

Answer:

BMI or 95th

Explanation:

It's according to there height and weight when they are classified as obese

You find an infant who is unresponsive, is not breathing, and does not have a pulse. You shout for nearby help, but no one arrives. What action should you take next

Answers

Call 911, begin chest compressions immediately

What type of theorist is most likely to assess people's personalities

Answers

Psychoanalytic type of theorist is most likely to assess people's personalities by having them draw pictures, in the hope that the drawings will reveal underlying personality characteristics.

What is Psychoanalytic theory?

Psychoanalytic theory explain human behavior in respect of the interaction of various components of personality.

For example, A 20-year old, healthy and well built, has a irrational fear of mice. The fear makes him shake at the sight of a mouse or rat. He often finds himself in awkward situations because of the fear.

For more information regarding psychoanalytic theory, visit:

https://brainly.com/question/7929112

#SPJ4

On the advice of her therapist, thora decides to treat her fear of heights by exposing herself to heights using a stimulus hierarchy. which form of therapy is she using?.

Answers

The form or kind of therapy that she (Thora) is using is known as systematic desensitization.

What is systematic desensitization?

Systematic desensitization is a type of therapy in which a person is treated with a given stimulus to avoid negative outcomes.

This treatment involves a repetitive and systemic pattern of desensitization in the individual.

In conclusion, the form or kind of therapy that she is using is known as systematic desensitization.

Learn more about systematic desensitization here:

https://brainly.com/question/14263540

#SPJ1

Some scientists do not subscribe to mind-body therapy as a legitimate medical intervention. why do you think this is? what evidence could you provide to validate the power of biofeedback?

Answers

Some scientists do not subscribe to mind-body therapies because there are diseases that need to be treated by tangible methods (e.g., gene therapy), whereas biofeedback refers to a self-regulation technique.

What is biofeedback?

Biofeedback can be defined as a mind-body strategy aimed at improving cognitive and physical health by means of self-voluntary control of physiological functions.

Mind-body therapies include:

acupunctureyogamassages relaxation techniques

In conclusion, some scientists do not subscribe to mind-body therapies because they have a mechanistic point of view.

Learn more about mind-body therapy here:

https://brainly.com/question/25960579

#SPJ4

A client is drinking 3000 mL of fluid a day during the acute phase of kidney failure. Which assessment finding would be expected

Answers

During the day, provide the customer with proportional fluids; at night, give them less.

What is the acute renal failure of the kidney?

Acute renal failure, also known as chronic kidney disease, is the gradual deterioration of kidney function, which is responsible for removing waste and excess water from the body.

When a patient is on a 1000 mL fluid restriction for a 24-hour period, a nurse or authorized health professional must schedule the fluids that the patient can drink during the day (the nurse should include liquids found in food on this schedule), and this schedule must warn the patient not to drink at night to avoid aspiration.

Learn more about Kidney failure here:

https://brainly.com/question/7140809

#SPJ1

In this model of the rock cycle, A represents

rock and arrow B represents the process of

.

Answers

In this model of the rock cycle, A represents metamorphic rock and arrow B represents the process of weathering.

What is a rock cycle?

A rock cycle simply refers to a concept that is used to describe and illustrate the continuous chemical and biological processes that leads to the formation (creation) of a rock, its transformation from one kind to another, its destruction and reformation over a specific period of time.

In Science, some examples of the natural phenomenon that influences rock cycle are;

Plate tectonic activityErosionWeathering

Weathering involves both the physical and chemical breakdown of rock into smaller pieces while metamorphic rock is a type of rock which is formed due to the transformation of an existing rock.

Based on the model in the image attached below, we can infer and logically conclude that item A represents a metamorphic rock while arrow B represents the process of weathering.

Read more on rock cycle here: https://brainly.com/question/15619429

#SPJ1

Which cells participate in this effort to control tissue injury associated with the second stage of the inflammation process

Answers

Answer:

neutrophils

Explanation:

trust me bro

Answer: neutrophils
My way to put the meaning is a kind of white platelet that is a significant piece of the invulnerable framework and assists the body with battling disease.

What is the most important reason that a Certified Personal Trainer should make sure an older adult has been cleared by the medical provider to take part in a balance training program

Answers

The most important reason why Certified Trainer should ensure an older adult has been cleared by the medical provider to take part in training is to  is to ensure safety.

What is Safety?

This is a condition which depicts freedom from danger or harm due to the different techniques and precautions employed.

A medical provider has the health history of an older adult and is in the best position to tell the certified personal trainer if he/she can take part in balance training program to prevent any form of harm or death during such activity.

Read more about Safety here https://brainly.com/question/8430576

#SPJ1

A young woman in her first trimester of pregnancy goes to her doctor after experiencing heavy bleeding. After examining the woman and finding that she has miscarried, the doctor states that she has had a “spontaneous abortion.” The young woman becomes very upset because her family believes that abortion is a sin.

Explain the breakdown in communication that has occurred and how it could be corrected.

Answers

Explanation:

it was a miscarriage but the term that it is refered to is spontaneous abortion

Of the required continuing education credits for each license renewal, only
half of the total credits may be self-study.
True
False

Answers

This is in fact true

Of the required continuing education credits for each license renewal, only half of the total credits may be self-study. Thus, the given statement is true.

What is continuing education credits?

A continuing education unit (CEU) is also known as continuing education credit (CEC). It is a measure used in continuing the different education programs to assist the professionals to maintain their license in their profession.

Continuing education or professional development is required in many fields in community, including teachers, insurance professionals, interior designers and interior architects, engineers, emergency management professionals, nurses as well as those who are working in the mental health profession including psychologists and social workers. The continuing education unit is usually described as a ten hours of participation in an education program.

Learn more about Education credits here:

https://brainly.com/question/28344667

#SPJ2

A nurse is collecting a specimen for an aerobic culture from a client who has draining pressure injury. identify the sequence of actions the nurse should take

Answers

Obtain a culturette tube and use sterile technique is the sequence of  actions the nurse should take.

What is a Specimen?

This is defined as a part of an organism which is usually taken for testing in the laboratory.

The injury should first be cleaned with saline before obtaining the culture as the resident bacteria on the skin may not be the cause of the injury.

Read more about Specimen here https://brainly.com/question/11786631

#SPJ4

Richard was referred to dr. krueger a cardiologist by his pcp dr. smith due to an abnormal electrocardiogram. dr. krueger performs a detailed history and examination with a low complexity medical decision-making. this is reported with code _________.

Answers

Dr. krueger performs a detailed history and examination with a low complexity medical decision-making. this is reported with code ICD 10 - I51.

What is the ICD l10?

The simplified nomenclature “International Classification of Diseases” refers to epidemiological-based instruments that organize information on

diseasessignssymptomsabnormal findingscomplaintssocial circumstances and external causes.

ICD-10, the tenth version of the document, was approved in 1994.

Richard was referred to dr. krueger a cardiologist by his pcp dr. smith due to an abnormal electrocardiogram. dr. krueger performs a detailed history and examination with a low complexity medical decision-making. this is reported with code ICD 10 - I51

With this information, we can conclude that Dr. krueger performs a detailed history and examination with a low complexity medical decision-making. this is reported with code ICD 10 - I51.

Learn more about ICD 10 in brainly.com/question/14819864

#SPJ1

According to communications theory, health families are able to adapt to changing circumstances through use of:

Answers

Answer:

Positive feedback

Explanation:

describe 3 ways in which the organs of the circulatory system and respiratory system are protected .

Answers

Answer:

-Skin

Your skin is a water-proof organ surrounding your whole body protecting it from bacteria and temperature to name a few.

-Ribcage

The ribs are horizontal bones held up between your sternum and vertebral column which protect your heart and lungs.

-Immune system

Your immune system has a set of cells that defend all organs from disease

An older adult client is newly diagnosed with hypertension. Which vascular changes in the aging adult can lead to hypertension

Answers

Arteriosclerosis is the vascular changes in the aging adult can lead to hypertension.

What is Arteriosclerosis?

This is a condition where the large arteries become stiff as a result of build up of fats etc in them. This prevent the easy passage of blood and adds extra load on the heart to pump it to other oarts of the body.

This increases pressure on the heart which therefore leads to hypertension in this scenario.

Read more about Arteriosclerosis here https://brainly.com/question/685228

#SPJ1

Andy has diabetes and he is not good about taking his medications or even checking his insulin levels. his doctor has recently started using mobile health (mhealth). how will andy's doctor's use of mhealth help andy get his diabetes under control

Answers

Answer:

Captioning software can be used to transcribe what is being said.

Explanation:

The utilization of mobile health by Andy's doctor significantly helps Andy to control his diabetes. This is due to the expression of his diabetes level all-time on the mobile screen even after the consumption of a glass of water.

What is Diabetes?

Diabetes may be defined as a type of chronic disease that occurs when the pancreas is no longer capable to synthesize a hormone known as insulin, due to which the level of blood glucose gradually and continuously increases.

It is hard to regulate the consequence which is not directly visible to us. But if it has proper tracking and one must get the information of the consequence regularly, it is possible to control it.

The same principle is applied here in the regulation of diabetes for Andy. If he is aware of all sorts of diet and the level of glucose it contains, he significantly becomes more determined in order to regulate or control his diabetes.

Therefore, the utilization of mobile health by Andy's doctor significantly helps Andy to control his diabetes.

To learn more about Diabetes, refer to the link:

https://brainly.com/question/515317

#SPJ2

The nursing instructor asks a nursing student to explain the characteristics of the amniotic fluid. the student responds correctly by explaining which as characteristics of amniotic fluid

Answers

Answer:

Allows for fetal movement

Is a measure of kidney function

Surrounds, cushions, and protects the fetus

Maintains the body temperature of the fetus

You note that the body temperature of one of your patients is starting to increase. As a result, you can infer that all of the following may be occurring in this patient except __________.

Answers

Answer:

dilation of blood vessel

21) what is provided to the provider's office when a claim has been processed?

a. coding report

b. provider voucher

c. clearinghouse report

d. provider inquiry

Answers

Answer:

a. coding report

Explanation:

from what i have bin reading

Answer:

Providers enquiry

Explanation:

The provider's office need the all time report for the claim by health insurance company or hospital.When the claim has been processed an enquiry of provider is provided

Option A is correct

A client confides that she is taking laxatives to help her lose weight. What is the best course of action

Answers

Recommend that she slowly stops using laxatives. Taking her straight off them while she’s had longterm usage can cause bowel obstructions and dietary issues. Probably see her again in a couple weeks and come up with a healthy diet/exercise plan and stick to it.
Other Questions
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1) Read the excerpt from Brown v. Board of Education.Therefore, we hold that the plaintiffs and others similarly situated for whom the actions have been broughtare, by reason of the segregation complained of, deprived of the equal protection of the laws guaranteed bythe Fourteenth Amendment.Why does the Supreme Court conclude that the plaintiffs have been denied their rights?O The plaintiffs' schools have neglected their responsibilities.O The Fourteenth Amendment fails to reference education.Segregation is inherently unequal and unfair.The plaintiffs' children have endured racial stereotyping. Tengo que hacer una historia de un mundo distopico ayuda