determine whether each pair of triangles is congruent. if so, write a congruence statement and explain why the triangles are congruent. (lesson 5-5) 4. b c n r p f m d 5. a l e

Answers

Answer 1

No, these two triangles are not congruent. Congruent triangles have the same shape and size, and Triangle ABC and Triangle DEF do not have the same shape or size.

Congruent triangles are two triangles that have the same shape and size. This means that the angles and the side lengths of the two triangles must be the same. For example, if two triangles have three angles that measure 60°, 60°, and 60°, the two triangles are congruent. Similarly, if two triangles have three side lengths of 5 cm, 6 cm, and 7 cm, the two triangles are also congruent. However, Triangle ABC and Triangle DEF do not have the same shape or size, therefore, they are not congruent. The angles and side lengths of the two triangles are not the same, so they cannot be congruent.

Learn more about triangle here

https://brainly.com/question/2773823

#SPJ4

the complete question is

determine whether each pair of triangles is congruent. if so, write a congruence statement and explain why the triangles are congruent.

Triangle ABC and Triangle DEF


Related Questions

BRAINLIEST!!! find the probability for numbers 11 and 13 please

Answers

Answer: probability of 11 = 5.56% probability of 13 = 52

Step-by-step explanation:

The area of a rectangle with a
length of 10 cm and a width of 3
cm.

Answers

Answer:

30 cm2

Hope this helps

Answer:

30

Step-by-step explanation:

A=w*l=3·10=30

BRAINILEST PLEASE

Select the most accurate statement regarding the normal distribution. Group of answer choices It is always the appropriate distribution in simulation modeling. It does not permit negative values. There is a 95% chance that values will be within ±2 standard deviations of the mean. The user must specify the maximum positive value allowed. It is obtained by the positive and negative square roots of a uniform random variable.

Answers

Answer:

There is a 95% chance that values will be within ±2 standard deviations of the mean.

Step-by-step explanation:

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

The Empirical Rule states that, for a normally distributed random variable:

Approximately 68% of the measures are within 1 standard deviation of the mean.

Approximately 95% of the measures are within 2 standard deviations of the mean.

Approximately 99.7% of the measures are within 3 standard deviations of the mean.

In this question:

According to the empirical rule, 95% of the measures are within 2 standard deviations of the mean. So the correct statement is:

There is a 95% chance that values will be within ±2 standard deviations of the mean.

PLEASE HELP !! ILL GIVE BRAINLIEST !! 100 POINTS

Answers

Answer:

D) ONK and MNK

Step-by-step explanation:

All the other choices are either corresponding or vertical angles

(please answer if you know) On a​ map, 1 inch equals 5.2 miles. Two houses are 3.5 inches apart on the map. What is the actual distance between the​ houses? Use pencil and paper. Show how you can represent the scale with two different ratios. What ratio is more helpful for solving the​ problem? Explain.

Answers

18.2 is the answer . work = (5.2/2)+5.2(3)

⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️HELP HELP HELP HELP - A triangle has side lengths of 7, 23, and 25. Is the triangle a right triangle? *
Yes, the triangle is a right triangle.
No, the triangle is not a right triangle.
There is not enough information to tell if the triangle is a right triangle.

Answers

Answer:

No, the triangle is not a right triangle

Step-by-step explanation:

Answer:

To determine if the triangle is a right triangle, we can use the Pythagorean theorem, which states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides.

Let's check if the given triangle satisfies the Pythagorean theorem:

7^2 + 23^2 = 49 + 529 = 578

25^2 = 625

Since 578 is not equal to 625, the triangle does not satisfy the Pythagorean theorem. Therefore, the triangle is not a right triangle.

PLEASE MARK AS BRAINLIEST

Find the distance between the points (4.5,-1.5), (4.5,7.25)
The distance is ____.

Answers

Answer:

8.75

Step-by-step explanation:

At a school carnival, 51 out of 68 tickets sold were early-admission tickets. What percentage of the tickets were early-admission tickets?

Answers

Answer:

75% of the tickets sold were early-admission

Simplily divide 51/68

A box of donuts cost $9. You want to send donuts to the local nursing home. Set up an equation to find how many boxes you can send if you have $72.

Answers

Answer:

8 boxes of donuts

Step-by-step explanation:

72$ /9$ = 8 boxes of donuts

if 40% percent is a number of 35 what is 50% of that number

Answers

Answer:

what is 50% of 35?

Answer is 17.5.

Step-by-step explanation:

Jill wants to paint the front and top surfaces of each step leading to her porch. There are 6 steps like the one shown. How many total square inches of the steps will she paint?

A: 1,296

B: 1,776

C: 3,552

D: 5,760​

Answers

Answer:

1296

Step-by-step explanation:

12 multiplied by 8 gives 96 which is the total square inches of the front step. 12 times 10 is 120 giving you the total square inches of the top. 120 + 96 gives you 216. 216 multiplied by 6 gives you the total square inches of all 6 steps which is 1296.

The sales rate is 8%. If Janelle buys a gymnastics mat priced at $87 , how much tax will she pay?

Answers

Answer: $6.96

Step-by-step explanation:

To find out what 8% of $87 is, you have to convert the 8% into decimal form which is 0.08. Then you have to multiply  that by $87

87*0.08 = 6.96

Now, we know $6.96 is 8% of $87 which is how much she will be paying in tax

I will give Brainliest answer!

What is the volume of the cylinder below? write your answer in terms of pie.

Height= 11.5 cm
Radius= 6 cm

Answers

Answer:

414π

Step-by-step explanation:

Volume of a cylinder = area of circle/ cross-section x height

Area of cross-section = πr² = 6²π = 36π

36π x 11.5 = 414π

Answer:

1300.61936 cm

Step-by-step explanation:

:))

what is the slope of 4x-3y=18

Answers

Answer:

Look below

Step-by-step explanation:

[tex]4x-3y=18\\-3y=18-4x\\y=4/3x-6[/tex]

Answer:

Slope: 4/3

y-intercept: -6

1. Tamekia and Marsha mow lawns during the summer to earn money. Tamekia
determined that she can earn between $6.00 and $6.25 per hour. Marsha
estimates that she earns between $7.50 and $8.00 per hour. About how much
more money will Marsha earn than Tamekia if they each work 22 hours? *
A. $65.01 to $85.00
B. $45.01 to $65.00
C. $25.01 to $45.00
D. $5.00 to $25.00

Answers

C 25.01- 45.00
Marsha will make 33-38 more dollars than tamekia

Answer:B

Step-by-step explanation:


izllllllllllllllllllll

Answers

Answer:

32 :P

Step-by-step explanation:

10x2 is 20, 6x2 is 12, and 12+20=32

Anyone who know what the answer please please?!

Answers

Answer:

x = 26.4°

Step-by-step explanation:

Defence angle = x

Side length Opposite to reference angle = 4

Hypotenuse length = 9

Apply trigonometric ratio, SOH. Thus:

Sin x = Opp/Hyp

Sin x = 4/9

[tex] x = sin^{-1}(\frac{4}{9} [/tex]

x = 26.3878° = 26.4° (nearest tenth)

-7x + 2y = -5
y = -7x + 8
explain how please

Answers

Answer:

x = 1 and y =1

Step-by-step explanation:

y = -7x + 8

sub into other eq

-7x + 2(-7x + 8) = -5

-7x - 14x + 16 = -5

-21x = -21

x - 1

y = -7(1) + 8

y = 1

PLs help me. I need to find the measure of B

Answers

Answer: 52

Step-by-step explanation:

cos=7/11.4 -> cos-1(cosB) = cos-1(7/11.4)

m<B = cos-1(7/11.4) = 52

guys someon about to comit u know what so go to this link and help out
https://brainly.com/question/22760250

Answers

Answer:

Is this called

BRAINLIEST WHO EVER ANSWERS FIRST !!!!!!I need someone to talk too! Please if anyone is willing to talk to me, I will give brainiest!

Answer:

A tropism (from Greek τρόπος, tropos, "a turning") is a biological phenomenon, indicating growth or turning movement of a biological organism, usually a plant, in response to an environmental sti

PLEASE HELPP!!!!

Please find the areas of these shape

Answers

The answer of the First one is 76

A class consists of 1/2 freshmen, 1/8 sophomores, and 1/8 juniors; the rest are seniors. What fraction of the class is seniors?

Answers

Answer:

2/8 are seniors

Step-by-step explanation:

one half = 4/8

4/8 + 1/8 + 1/8 = 6/8.

What's left is 2/8

A walking path 78 mile long Colleen planted 14 bushes the same distance apart along the path how far power are the 1st 2 bushes along the path​

Answers

Answer:

The bushes will be located 6 meters apart from each other.

Step-by-step explanation:

Given that at a walking path 78 mile long Colleen planted 14 bushes the same distance apart along the path, to determine how far away are the 1st 2 bushes along the path, the following calculation must be performed:

78/13 = X

6 = X

Thus, since the first bush is at meter 0, the remaining 13 bushes will be located 6 meters apart.

Problem Suppose an archaeologist finds a camel tooth that contains 42 % of original amount of C-14. Find age of the tooth. N = Noekt No = initial mass of C-14 (at time t= 0) N = amount of C-14 at time t k= 0.0001 t = time, in years Since, our equation can be written like this: 0.42 No = Noe Noe -0.00010​

Answers

Answer:

8,675

Step-by-step explanation:

please help i have been stuck on this for 3 hours

Answers

Answer:

The one you selected is the correct one

Answer:

(5/7) x 56 = 40 is correct

Step-by-step explanation:

How have you been stuck on this for 3 hours

WILL MARK BRAINLY FOR WHO EVER GETS THIS RIGHT

Answers

Answer:

The first option and the third option

Step-by-step explanation:

Since the figure moved 4 places down and 4 places to the right.

Answer:

Option 1, ,2, 3, and 4 are correct.

Step-by-step explanation:

Have a nice day!

Hey guys, I just got braces and they are really uncomfy so how long did it take yall to get used to them?

Answers

Answer:

it took me like 1-2 months to be honest. after that it just feels normal

Step-by-step explanation:

I had them and it took about a month or two

4. Are the expressions 3(y + 1) and 3y + 3, equivalent for y = 1? y= 2? y 3?​

Answers

Answer:

yes they both equal 1

Step-by-step explanation:

The length of one rectangle is 3 1/2 mm with a width of 2 4/5 mm . What is the area of the rectangle?

Answers

Answer:

9.8

Step-by-step explanation:

Pleaseee helppp me on this

Answers

Answer:

(-7,-13) (-6,-12) (3,-3) (5,-1) (7,1)

Step-by-step explanation:

plug in each x value into the equation

take -7 for example

when -7 is x, we plug it into the equation

[tex]y=x-6[/tex]

[tex]y = (-7) -6[/tex]

[tex]y=-13[/tex]

you would do this same process for the rest of the x values.

Other Questions
Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number. Complete the proof.Given: ABBP=CBBMProve: CBA~PBM Below shows a process that occurs in cells. The type of building blocks represented by the letters A, B, and C in this process are:A: NucleotidesB: CodonsC: Amino AcidsD: Nitrogen bases