GIVING BRAINLIEST!!!!

Name the types of adaptation that animals and plants can have

GIVING BRAINLIEST!!!! Name The Types Of Adaptation That Animals And Plants Can Have

Answers

Answer 1

Answer:

poison, thorns, sharp teeth

Explanation:


Related Questions

Consider the relationship between UV exposure (e.g. UV exposure...
Consider the relationship between UV exposure (e.g. UV exposure time) and colony formation in trp1-289 yeast plated on SD medium. (1pt) Would you predict there to be a positive or negative relationship between UV exposure and colony formation (i.e. number of colonies) in trp1-289 yeast plated on SD medium. Why? (1pt) If you were to graph this relationship, which variable (i.e. number of trp1-289 colonies on SD medium or UV exposure time) would go on the x-axis and which would go on the y-axis? (1pt) Explain why this relationship might not be linear? (Hint: use the information you generated in Q3&4 above). Include a description of what this relationship might look like?

Answers

The relationship between UV exposure and colony formation is negative.

There is a negative relationship between UV exposure and colony formation in trp1-289 yeast plated on the SD medium. This is because UV exposure can cause DNA damage, which can lead to decreased viability and colony formation in yeast.

The UV exposure time would be placed on the x-axis, representing the independent variable. The number of trp1-289 colonies on the SD medium would be placed on the y-axis, representing the dependent variable.

The relationship between UV exposure and colony formation might not be linear due to several factors. The relationship might exhibit a sigmoidal or exponential decay curve.

Learn more UV exposure, here:

https://brainly.com/question/29289143

#SPJ4

Innate defenses include mechanical and chemical barriers, whereas adaptive defenses counter specific disease-causing agents.

True or False

Answers

True have a good one :)

Which molecules are used for releasing energy in the cell
1. glucose, carbon dioxide and water
2glucose, oxygen and amino acids
3glucose and oxygen
4glucose and amino acids

Answers

Answer: glucose and Oxygen

Explanation: Glucose is converted to water and carbon dioxide in mitocondries and energy is released. Oxygen is needed to reaction.

Amino acids can be converted to energy but that is not primary purpose of amino acids.

How does binomial nomenclature help scientists?

help!!!​

Answers

Answer:

Explanation:

Bionomial nomenclature helps scientists by helping them classify organisms. This would be a two-name system that scientists use that describes the genus and species of the organism.

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3´

Answers

The correct mRNA sequence transcribed from the given DNA sequence is: 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' Here option B is the correct answer.

To determine the correct mRNA sequence transcribed from the given DNA sequence, we need to apply the rules of DNA transcription. During transcription, the DNA sequence is used as a template to synthesize an mRNA molecule, with the RNA base uracil (U) substituting for thymine (T) in the DNA.

The given DNA sequence is:

5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

To transcribe this DNA sequence into mRNA, we replace each DNA base with its RNA counterpart:

G (Guanine) → C (Cytosine)

C (Cytosine) → G (Guanine)

A (Adenine) → U (Uracil)

T (Thymine) → A (Adenine)

Applying these conversions, we get the mRNA sequence:

5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

Therefore, option b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' represents the correct mRNA sequence transcribed from the given DNA sequence.

To learn more about mRNA

https://brainly.com/question/29314591

#SPJ4

Complete question:

Which of the following represents the correct mRNA sequence transcribed from the given DNA sequence?

a) 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'

b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

c) 5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'

d) 5' GGGATCGATGCCCCTTAAAGAGUUUACAUUAUUGCUGGAGGCGUUAACCCCGGA 3'

Match each statement in the left column with the most likely characteristic in the light column. On June 21st. ✓[Choose] 34 degrees the declination of the Sun is 3 degrees north On March 20/2020 is the longest day of the year in the Southern Hemisphere it is the longest day of the year in the Northern Hemisphere On On January 10th, on the Equator, the Solar Altitude is northernmost latitude where the sun rays strike the Earth's surface perpendicularly... 54 degrees the day and night were 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres 67 degrees N On March 29th 68 degrees farthest distance from the Pole where the sun rays are tangent to Earth's surface. On July 3rd, the latitude of the tangent rays of the Sun is [Choose] On December 20th [Choose] The Tropic of Cancer (23.5 degrees N) is the [Choose] The Antarctic Polar Circle (66.5 degrees 5) is the [Choose ] On January 30th, the solar altitude in Central [Choose] California (about 38 degrees N), is: On April 22nd, the solar altitude in Seattle (about 48 degrees north) is: [Choose]

Answers

On June 21st: The declination of the Sun is 23.5 degrees north.

On March 20/2020: It is the longest day of the year in the Northern Hemisphere.

On January 10th, on the Equator: The Solar Altitude is 90 degrees.

On March 29th: The day and night are 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres.

On July 3rd: The latitude of the tangent rays of the Sun is 23.5 degrees north.

On December 20th: The Tropic of Capricorn (23.5 degrees south) is the farthest distance from the Pole where the sun rays are tangent to Earth's surface.

On January 30th, the solar altitude in Central California (about 38 degrees N): [Choose]

On April 22nd, the solar altitude in Seattle (about 48 degrees north): [Choose]

Explanation to the above short given answers are written below,

On June 21st, the declination of the Sun is 23.5 degrees north. This means that the Sun is at its highest point in the sky in the Northern Hemisphere, marking the summer solstice.

On March 20th (or around that date), it is the longest day of the year in the Northern Hemisphere. This is the vernal equinox, when the Sun is directly over the Equator and day and night are approximately equal in length.

On January 10th, on the Equator, the Solar Altitude is 90 degrees. This means that the Sun is directly overhead at noon, resulting in a vertical angle of 90 degrees between the Sun and the observer on the Equator.

On March 29th, the day and night are approximately 12 hours long anywhere between 0 and 60 degrees latitude in both hemispheres. This is around the time of the equinoxes when the length of day and night is equal.

On July 3rd, the latitude of the tangent rays of the Sun is 23.5 degrees north. This corresponds to the Tropic of Cancer, the northernmost latitude where the Sun's rays strike the Earth's surface perpendicularly.

On December 20th, the Tropic of Capricorn (23.5 degrees south) is the farthest distance from the Pole where the sun rays are tangent to Earth's surface. This marks the summer solstice in the Southern Hemisphere.

The solar altitude in Central California on January 30th and the solar altitude in Seattle on April 22nd are not provided, so the answers for these statements are missing.

To know more about "Summer solstice" refer here:

https://brainly.com/question/4172420#

#SPJ11

All of the following are possible fates of fatty acid that enters the liver except: S

A. Conversion to ketone bodies
B. Conversion to acetyl-CoA for cholesterol synthesis
C. Use as an energy source
D. Conversion to triacylglycerol
E. Conversion to glucose

Answers

Conversion to glucose. Fatty acids cannot be directly converted to glucose in the liver through a process called gluconeogenesis. The correct option is E

What is Gluconeogenesis ?

The liver uses a process called gluconeogenesis to convert fatty acids indirectly into glucose. The process of producing glucose from non-carbohydrate sources, such as amino acids or glycerol, but not from fatty acids, is known as glucoseneogenesis.

Fatty acids can go through a variety of metabolic processes in the liver, including being converted to ketone bodies, being used as an energy source, being converted to acetyl-CoA for the production of cholesterol, and being converted to triacylglycerol for storage or transportation. They cannot, however, be changed into glucose.

Learn more about Gluconeogenesis here : brainly.com/question/9192661

#SPJ1

TRUE/FALSE> littoral zones are more likely to contain vegetation than riparian zones. please select the best answer from the choices provided

Answers

Littoral zones are more likely to contain vegetation than riparian zones. This statement is TRUE.

Littoral zone: This is the region of a body of water close to the shore. The littoral zone is the area of the lake where the rooted plants are able to grow. It is the area of the lake where sunlight penetrates all the way to the sediment and allows aquatic plants to grow. Therefore, the littoral zone is more likely to contain vegetation than riparian zones. Riparian zone: This is the area adjacent to a stream or river. Riparian zones are unique and provide a diverse range of habitats for different species. The vegetation in this zone is very important for the proper functioning of stream and river ecosystems. While it may contain vegetation, the likelihood is lower than that of the littoral zone.

For further information on Vegetation zones visit:

https://brainly.com/question/8332741

#SPJ11

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

state two factors on which the gravitational force between two objects depends.​

Answers

Answer:

Gravitational Force depends on two factors:

1. Product of mass of two object

2. Square of distance between their centers

Mathematically,

  F = G *(m1* m2)/d²

Explnation:

Solar Energy Supply Part 3 0.0/5.0 puntos (calificado) How much land would be required if the solar installations were in the much-less-sunny northeast US, producing 7.5W/m² on average? sq km Enviar

Answers

X MW / 0.0000075 MW/km² land area would be required if the solar installations were in the much-less-sunny northeast US, producing 7.5W/m² on average.

To calculate the land required for solar installations in the much-less-sunny northeast US, producing an average of 7.5W/m², we need to consider the energy output per unit area and the total energy demand.

Let's assume that the total energy demand in the northeast US is X megawatts (MW). To convert this demand into the required land area, we need to divide the total energy demand by the average energy output per unit area.First, we need to convert the average energy output from watts per square meter (W/m²) to megawatts per square kilometer (MW/km²). Since 1 MW is equal to 1,000,000 W and 1 square kilometer is equal to 1,000,000 square meters, we can convert the average energy output as follows:

7.5 W/m² = 7.5/1,000,000 MW/km² = 0.0000075 MW/km²

Next, we divide the total energy demand (X MW) by the average energy output per unit area to find the land area required:

Land area required = X MW / 0.0000075 MW/km²

The resulting value will be in square kilometers (km²), which represents the land area required for the solar installations in the much-less-sunny northeast US to meet the energy demand.

It's important to note that the exact total energy demand and the specific conditions of the solar installations may vary, so this calculation provides a general approach to estimate the land area required based on the given average energy output per unit area.

know more about solar installations click here:

https://brainly.com/question/32262153

#SPJ11

Where does the growth of plants occur.

Answers

Answer:

the tips of the steams and roots, also known as an apices

Answer:

The growth in plants can occur in or as the stems and including the roots lengthens or grows. Thus, some plants and including the ones that are woody, Which can increase in thickness during their life span. The increase causes in length or the growth of the shoot and of course the root., which is mostly referred as primary growth. This is the result of a cell division in the shoot apical meristem.

What is the difference between a) prokaryote and eukaryote; b) autotroph and heterotroph; c) unicellular and multicellular?

Answers

Answer:

Explanation:

a) eukaryotes have membrane bound organelles like nuclei while prokaryotes don't

b) autotrophs = producers that can make their own food while heterotrophs consume producers or other consumers

c) Unicellular organisms are made up of only one cell that carries out all of the functions needed by the organism, while multicellular organisms use many different cells to function

A circuit consists of a wire, a lightbulb, a switch, and a battery. What would happen if the battery were replaced with a section of wire?

Answers

The circuit would have no voltage and no current.




bynummeeks24

10/08/2020

BiologyHigh School

answered

Which of the following best describes how a channel protein moves materials across the membrane? A)They provide a carrier for specific molecules to bind to and cross the membrane via endocytosis. B)They provide a passage for specific molecules to cross the membrane via passive transport. C) They provide a tunnel for solutes to cross the membrane via active transport. D) They provide energy needed for solutes to cross the membrane via facilitated diffusion.

Answers

The correct option that best describes how a channel protein moves materials across the membrane is B) They provide a passage for specific molecules to cross the membrane via passive transport.

Channel proteins are integral membrane proteins that form channels or pores in the cell membrane. These channels allow the passive transport of specific molecules or ions across the membrane down their concentration gradient. This process is called facilitated diffusion, where the molecules move from an area of higher concentration to an area of lower concentration without the need for energy input. The channel proteins provide a selective passage for these molecules, enabling their movement across the membrane.

Therefore, the correct answer is B) They provide a passage for specific molecules to cross the membrane via passive transport.

For more details regarding passive transport, visit:

https://brainly.com/question/29764225

#SPJ4

cystic fibrosis is a genetic disease that leads to the production of excessive thick mucus in the respiratory tract, leading to frequent and serious respiratory infections. the defect is due to the production of a faulty membrane protein for the transport of the chloride ion. the protein is still in the membrane; it just doesn't function normally. what type of membrane protein is being affected in this case?

Answers

The type of membrane protein that is affected in cystic fibrosis is a chloride ion channel.

What is Cystic fibrosis?

Cystic fibrosis is an inherited condition in which the mucus in the body becomes thick and sticky. It can cause breathing difficulties and frequent infections, among other symptoms. Because the mucus is thicker than normal, it can obstruct the ducts of the pancreas, preventing digestive enzymes from reaching the small intestine.Cystic fibrosis is an autosomal recessive genetic disorder.

This means that in order to inherit the disease, a person must inherit two copies of the mutated gene, one from each parent.

What is the cause of cystic fibrosis?

Cystic fibrosis is caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane conductance regulator. This protein functions as a chloride ion channel, which helps regulate the flow of salt and fluids in and out of cells.

However, in people with cystic fibrosis, the CFTR protein is either missing or not functioning properly due to a genetic mutation. As a result, the salt and water balance is disrupted, leading to the production of thick, sticky mucus that clogs the airways, digestive tract, and other ducts in the body.

To know more about cystic fibrosis, refer here:

https://brainly.com/question/31366825#

#SPJ11

What allele pairs will result from this combination of alleles MmQq? ( use the 13,14,23,24 strategy).
A). All of these are correct
B). MQ, Mq, mQ, mq
C). Mq, mQ, mq, Mq
D). MM, mm, QQ, qq

Answers

The answer is B). MQ, mQ, Mq, mq

You are a geneticist working at a veterinary hospital. Your job is to help people understand genetic disorders that could affect their pets.

Answers

Answer:

To be connected with pet owners.

Explanation:

For doing this job, i have to be connected with the people having pets in their houses because with this interaction I provide all information about genetic disorders that their pet can gain. I will attend group discussion with these people in order to avoid threats of genetic disorder to their pets. With this information, these people are able to diagnose any genetic disorder symptoms in their pets and if we knew on time this genetic disorder can be eliminated from their pets and their health should be maintained.

You aim to chemically synthesize four peptides with the following one-letter amino acid sequences: TIGER, PANTHER, CHEETAH, and CAT. A.Which one of these peptides will have the lowest pl? Give a reason for your answer. You are not required to calculate the pls of the peptides to answer this question. A qualitative knowledge of the ionization properties of amino acids discussed in class is sufficient to answer this question (4 points). B. Based on what we learned in the lectures, draw the titration curve for the GEAR peptide in the pH range 0-14. Make sure to label the two axes, and the pk1, pk2, and pkr values on the curve. If there are multiple R groups that titrate, indicate the pkrs as pKR1, PKR2 etc. You are not required to write out the chemical structures of the various titration intermediates (8 points). C. While entering the sequence in into the automated peptide synthesizer you mistakenly type in CHETAH instead of CHEETAH. So, you synthesize a peptide with the wrong sequence. However, you realize something is wrong as soon as you do a pH titration of the peptide. What is one difference be- tween the pH titration curves for the peptides CHEETAH and CHETAH? You can either answer in words alone or with help of pH titration curves (4 points).

Answers

The peptide CAT is expected to have the lowest pI due to its composition of basic amino acids.

The pI of a peptide is influenced by the ionizable amino acid residues it contains. CAT, among the given peptides, is composed mainly of basic amino acids such as arginine and lysine. These basic amino acids have higher pKa values for their side chains, resulting in a net positive charge at lower pH values.

The pI is the pH at which a peptide carries no net electrical charge, and in the case of CAT, it is likely to be lower due to the prevalence of basic amino acids. Peptides with acidic or neutral amino acids would have higher pI values, as their side chains have lower pKa values and tend to be negatively charged at lower pH values.

To learn more about peptide follow the link:

https://brainly.com/question/32355776

#SPJ4

The question is inappropriate, the correct question is:

You aim to chemically synthesize four peptides with the following one-letter amino acid sequences: TIGER, PANTHER, CHEETAH, and CAT. A.Which one of these peptides will have the lowest pl? Give a reason for your answer. You are not required to calculate the pls of the peptides to answer this question.

Of the three major types of handwriting characteristics line form includes, smoothness of the lines,
pen pressure, and slant
True or False?

Answers

answer: true

explanation:

what might a zoologist notice about birds caged indoors if she were looking for clues that they follow a biological rhythm in natural settings?

Answers

A zoologist notice about birds caged indoors if she were looking for clues that they follow a biological rhythm in natural settings she would observe the birds' behavior closely to detect if they follow a circadian rhythm which is a biological process that occurs within a 24-hour cycle.

The zoologist might notice that the caged birds appear to be restless or sleepless, suggesting that they are uncomfortable or out of sync with their natural rhythms. This is because birds are diurnal animals and require sunlight for proper bodily functions. The zoologist might also observe that the caged birds become increasingly agitated or active during certain times of the day.  This would suggest that the birds are naturally active during those periods in the wild and have maintained this behavior in captivity, indicating a biological rhythm.

Furthermore, the zoologist may notice changes in the bird's behavior in response to changes in lighting, as light is a key regulator of biological rhythms. Birds require a certain amount of light exposure during the day to function properly, and the absence of natural light could disrupt their natural rhythms and cause adverse effects. In conclusion, if a zoologist were looking for clues that birds follow a biological rhythm in natural settings, she might observe changes in the birds' behavior in response to light, as well as changes in activity levels at certain times of the day.

To know more about circadian rhythm visit:

https://brainly.com/question/31022861

#SPJ11

What can adults do to shrink fat cells?

Answers

Answer: To shrink fat cells, you need to eat fewer calories than your body needs.

CREDIT: healthyeating

Answer:

eat healthily and exercise properly

Explanation:

Witch statement about human activity and the environment is NOT true?

Answers

No body can help u cuz where is the picture
are there answer choices?

The Earth rotates counterclockwise on its axis. Because of this, in which direction does the Moon appear to move across the sky?

A. from north to south

B. from south to north

C. from west to east

D. from east to west

Answers

Answer:

East To West

Explanation:

What is the purpose of vaccines?

to help your immune system prepare for diseases

to kill existing diseases in your body

to speed up your healing from diseases

to weaken diseases that affect your body

Answers

To help your immune system prepare for diseases
1 one is correct i am 100% sure i am right

Describe the added “costs” of sexual reproduction for an organism.

Answers

O_o

huh

-_0

Photosynthesis???????

Beneficial bacteria are found in our digestive tract

A. true
B. False

please help

I will give brainliest and 5 * and 10 points for the best answer

I don't want to see an link if I do you will be reported

Answers

(A), because there are bacteria your body don’t attack because they are helpful.

Classify each of the bones in the chart below as either long, short, flat, or irregular by placing a check mark in the appropriate column. Also use a check mark to indicate whether the bone is a part of the axial or the appendicular skeleton. Use Figure 8.1 as a guide. Axial Appendicular Short Flat Irregular skeleton skeleton Long Sternum Radius Parietal bone (cranial bone) Phalanx (single bone of a digit) Vertebra

Answers

"The classification of each bone according to its type (long, short, flat, irregular) and whether it belongs to the axial or appendicular skeleton:

Bone                          Type                              Axial Skeleton                          Appendicular Skeleton

Sternum                           Flat                                   ✔

Radius                           Long                                                                                         ✔

Parietal bone                   Flat                                   ✔

Phalanx (single bone)   Long                                                                                          ✔

Vertebra                           Irregular                            ✔

Long Bones: The bones that are longer than they are wide are called long bones. These bones are found in the appendicular skeleton of the body. The Radius bone is an example of a long bone.

Short Bones: Short bones are as long as they are wide. They are primarily found in the wrist and ankle. The phalanx bone is an example of a short bone.

Flat Bones: Flat bones are thin and flat. These bones protect vital organs and provide a surface for muscle attachment. The Sternum bone is an example of a flat bone.

Irregular Bones: Irregular bones have irregular shapes. These bones play a vital role in protecting the nervous system and the organs in the thorax. The Vertebra bone is an example of an irregular bone.

Axial Skeleton: The axial skeleton consists of bones that lie along the longitudinal axis of the body. The Vertebra and Parietal bone is a part of the axial skeleton.

Appendicular Skeleton: The appendicular skeleton consists of bones that lie along the appendages of the body. The Radius and Phalanx are a part of the appendicular skeleton.

Bones in the human body serve several important functions:

1. Support: Bones provide structural support to the body, giving it its shape and framework. They form the rigid framework that supports and maintains the body's posture.

2. Protection: Bones act as protective coverings for vital organs. For example, the skull protects the brain, the rib cage protects the heart and lungs, and the vertebrae protect the spinal cord.

3. Movement: Bones, along with joints, muscles, and tendons, enable movement. They act as levers that are moved by muscle contractions, allowing us to walk, run, lift objects, and perform various activities.

4. Blood Cell Production: Bones house bone marrow, where red and white blood cells, as well as platelets, are produced. Red blood cells carry oxygen, white blood cells help fight infections, and platelets are essential for blood clotting.

5. Mineral Storage: Bones store minerals, primarily calcium and phosphorus, which are crucial for maintaining the body's mineral balance. When the body needs these minerals, bones release them into the bloodstream.

6. Energy Storage: Yellow marrow, found in the central cavities of long bones, stores fat as an energy reserve for the body.

7. Body Support and Balance: Bones provide support for soft tissues and muscles, allowing them to function effectively. They also contribute to maintaining balance and stability.

8. Sound Transmission: Bones in the middle ear, such as the ossicles (malleus, incus, and stapes), transmit sound vibrations from the outer ear to the inner ear, facilitating hearing.

These functions collectively make bones essential for the body's structure, movement, protection, and overall physiological well-being.

To know more about bones visit:

https://brainly.com/question/412179

#SPJ11

What is one disadvantage of desalination?

The process can ultilize solar energy to lower its cost.
The process uses fuel that is expensive.
The process makes water that is unsafe to drink.
The process is too difficult to carry out in big cities.

Answers

Answer:

B

Explanation:

Desalination remains expensive, as it requires enormous amounts of energy. The correct answer is b) The process uses fuel that is expensive.

What is desalination?

Saline water which is typically sea water, is artificially transformed into fresh water through a process called desalination. Reverse osmosis and distillation are the two most used desalination techniques. There are several approaches. Although each has benefits and drawbacks, they are all useful.

The issue is that it takes a lot of energy to desalinate water. When salt is dissolved in water, it forms strong chemical bonds that are challenging to break. Desalinating water may be rather expensive since both the energy and the technology required are costly.

Desalination turns seawater into freshwater by removing the salt, however, it also has certain unfavorable effects on the ecosystem. Desalination facilities release trash and poisonous chemicals that are bad for the environment and animals. The procedure can also increase the salinity of saltwater, which has an impact on fish.

Therefore, the correct answer is b).

For more details regarding desalination, visit:

https://brainly.com/question/19537065

#SPJ5

Other Questions
What is one way that people can harm the environment? Trees provide shade from the sun for humans and animals.Trees provide oxygen for humans and animals to breathe.Trees provide furniture like tables and chairs to use.Trees are beautiful to look at in parks and forests. 1. What is the value of the AMPLITUDE for WAVE A?2. What is the value of the WAVELENGTH for WAVE A? What is the unique role of the Georgia State Supreme Court? It evaluates the rulings of lower court. It makes decisions in civil court cases. It offers rulings on criminal court cases. It assesses the constitutionality of laws. (Present value) What is the present value of the following future amounts? a. $800 to be received 10 years from now discounted back to the present at 10 percent b. $300 to be received 5 years from now discounted back to the present at 5 percent c. $1,000 to be received 8 years from now discounted back to the present at 3 percent d. $1,000 to be received 8 years from now discounted back to the present at 20 percent greta has experienced severe major depressive disorder for the past three years. she calls her primary care physician complaining of stomach pains. her pcp explains that her depression and stress are probably the cause of her symptoms. he tells greta she does not need to be seen for an evaluation and to instead speak with her therapist. what has just occurred? Define Neutralisation reaction along with examples. (a) Consideration can be defined as "something of value in the eyes of the law", but consideration is not a critical factor factor to any contractual obligations and as such, it has to be ignored in any contract.Critically discuss this statement, with the following requirements;1. Five (5) applicable case laws on the subject matter.2. State clearly The issue Basic facts of the Cases The Judgement What is the value of x? Show me how you got your answer. Suppose the moral dilemma of "The Book of Martha" remained the same, but the theme was that people should collaborate on difficult decisions. What would Martha mostly likely do that would shape this alternate theme? A. She would refuse to make a decision and ask God to choose another person. B. She would consider how her ideas on population growth would affect others. C.She would ask to return home and talk with others about whether her experiences were real. D. She would ask God to choose other people to work with to make a decision. A local grocery store stocks packages of plain M&M's and packages of peanut M&M's. The ratio of the number of packages of peanut M&M's to the total number of packages on the shelf was 8 to 18.Which number could be the number of packages of plain M&M's on the shelf? How many solutions would there be for the following system of equations? y = 3x - 5 67 2g = 10 A 1 Solution B 2 Solutions c) No solution D Infinitely Many solutions If haploid for an organism is 30 individual chromosomes, how many individual chromosomes would a somatic cell for this organism possess?a. 15b. 10c. 90d. 60e. 30 1) (28 4) + 3 + (10 - 8) 5 2) 12 - 5 + 6 3 + 20 4 3) 36 9 + 48 - 10 2 4) 10 + 8 90 9 - 4 5) 8 3 + 70 7 7 Assume that Cane normally produces and sells 62,000 Betas and 82,000 Alphas per year. If Cane discontinues the Beta product line, its sales representatives could increase sales of Alpha by 17,000 units. What is the financial advantage (disadvantage) of discontinuing the Beta product line Quick question, whats your favorite thing about middle school? 5th grade math. correct answer will be marked brainliest Can someone please answer this for me? when a machine is ____________________, the hacker can back door into it at any time and perform actions from that machine as if she were sitting at its keyboard. A mom pushes her 19.3 kg daughter on the swing. If she gives her an initial velocity of 7.5 m/s at the bottom of the swing and the swing sits 0.6 m above the ground at it's lowest point, what height does she reach above the ground? What is the range for the following set of measurements?3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL