How can a kid make 100 dollars fast?

Answers

Answer 1

Ask your parents whether they would be willing to pay you to complete more challenging household tasks like cleaning the bathroom, mowing the grass, and doing the laundry. Make a list of the weekly jobs you could complete and assign a price to each one. Be sure you work hard enough to get $100!

Perform errands and various jobs around the house or community. Children who are old enough to assist with household chores and yard maintenance can receive payment. Families can, for instance, put a monetary value on chores like cleaning the house, vacuuming, folding laundry, and picking weeds. If you enjoy working outside, perform seasonal yard work in your area.

The tasks you can complete will change with the seasons, and there is always enough of yard and garden labor to be done. Offer to rake a yard's worth of leaves for $20 to $25, or inquire about neighbors' willingness to pay you $20 to $25 to shovel their road in the winter. By Pet-Sitting: Children can let neighbors know they are available to care for animals whenever needed, whether it is by feeding, walking, or attending to other requirements. Lemonade Stand: The age-old way for kids to make money is by operating a lemonade stand.

To learn more about dollars Visit : brainly.com/question/24278371

#SPJ4


Related Questions

What is the effect of rhyme in Shakespeare?

Answers

The effect of rhyme in Shakespeare is to enhance the sensory appeal of his plays and poems.

Rhyme creates an echo within the literary composition, which may leave an enduring impact on the audience. A writer will use rhyme in their work to evoke sensory appeal from their audience. Rhyme tends to be predictable however enjoyable. As such, it will produce suspense or dramatic tension.

William Shakespeare was an English author, writer and actor. he's wide considered the best author within the English language and therefore the world's pre-eminent writer. he's usually referred to as England's national writer and therefore the "Bard of Avon".

To learn more about Shakespeare here

brainly.com/question/25603233

#SPJ4

How different is Beowulf fight with Grendel from his fight with Grendel mother?

Answers

The method that Beowulf prepared for his fight with Grendel and Grendel's mother, as well as the circumstances and fighting style, were different.

This time, he dons his armor and weaponry and draws the sword Unferth gifted him. If we discuss the fight.

His struggle with Grendel's mother is not seen by any of his troops, in contrast to his fight with Grendel, who is. No one else is aware of what transpires in the mere as Beowulf battles Grendel's mother alone. Therefore, he is free to present whatever interpretation of the events; his immediate audience will have to believe Beowulf.

To know more about Beowulf poem, visit,

brainly.com/question/1830314

#SPJ4

What doe the Declaration of Independence ay about people' relationhip with their government?

Answers

That to secure these rights, Governments are instituted among Men, deriving their just powers from the consent of the governed, –That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it, and to institute new Government, laying its foundation on .

We believe that all men are created equal, that their Creator has endowed them with certain unalienable rights, among them are life, liberty, and the pursuit of happiness. That in order to guarantee these rights, governments are established among men, deriving their lawful authority from the.

The first phrase states the Declaration's fundamental objective, which is to clarify the colonists' right to revolution. In other words, "to declare the forces that drive them apart." Congress had to demonstrate the validity of its purpose.

Learn more about  Declaration of Independence to visit this link

https://brainly.com/question/14578050

#SPJ4

Is Snowball a good guy in Animal Farm?

Answers

As a bit of a daydreamer, Snowball envisions greater technological advancements on the farm and a revolution that could sweep all the way to England.

There are no consistently good or evil characters in Animal Farm, but Snowball is a more sympathetic and idealistic leader than Napoleon. He is not being selfish; instead, he genuinely wants what is best for the farm and the animals. In comparison to Napoleon, he is "a more vivacious pig, quicker in speech, and more inventive, but was not thought to have the same depth of character."

At first glance, Snowball resembles none other than Vladimir Lenin, the architect of the Russian Revolution of 1917. However, he resembles Lenin's deputy, Leon Trotsky, more.

To know more about Snowball, refer to this link:

https://brainly.com/question/29786248


#SPJ4

Which theme are found in The Odyssey?

Answers

The three main themes of this epic poem are hospitality, loyalty, and retribution. People are constantly in control of their decisions, but they are also open to divine intervention.

One's good reputation is their most prized possession in Odysseus' world. A story's central message is referred to as its theme. The author of the narrative is attempting to make this case. The subject of a narrative is typically a general lesson about life. The Odyssey, an epic poem by Homer, details Odysseus' ten-year journey home following the Trojan War. Penelope, his wife, and Telemachus stave off suitors competing for Penelope's hand and Ithaca's throne long enough for Odysseus to return while Odysseus fights mythical animals and endures the wrath of the gods.

To learn more about themes click here https://brainly.com/question/12461958

#SPJ4

What are the themes of Gothic literature?

Answers

Dark, ominous, and enigmatic, this genre frequently incorporates themes of terror, horror, the macabre, and the odd. Power, captivity, and isolation are typical Gothic themes and concepts.

Gothic literature is a literary genre that mixes sinister elements, eerie settings, troubled, disturbed characters, and whimsically horrible stories that are frequently romantic. It is the most sinister aspect of Dark Romanticism, which appeared immediately after the Romantic literary period. Gothic authors frequently employ melodrama or "great emotion" to make a point. This exaggerated, passionate language aids in expressing the anxiety and panic that are present in many personalities.

Numerous Gothic novels from the 20th century that portrayed psychosis featured themes of madness and mental misery.

Important Gothic Literary Elements:

A Dark, Haunted Environment.Dark and enigmatic atmosphereConnection to Extraterrestrial Powers.Extreme EmotionsThe Anti-Hero: The Protagonist.Female Victims.Portents and curses.Visions.

To learn more about Gothic literature Visit : brainly.com/question/1234077

#SPJ4

What is a split infinitive answers?

Answers

While an angle bisector divides an angle into two equal parts, a perpendicular bisector divides a line segment into two equal halves.

While the name of a line requires a double-headed arrow mark above it, the name of a line segment can be written by just calling it by its end points and a bar above it. Using a compass and the junction point of two arcs, we must create a perpendicular and an angle bisector. While an angle bisector divides an angle into two equal parts, a perpendicular bisector divides a line segment into two equal halves. By drawing two arcs, one above and one below the line segment, and connecting them with a straight edge, you can create a perpendicular bisector. Despite their similar sounds, lines and line segments are very distinct.

Learn more about Angle bisector here:

https://brainly.com/question/28669144

#SPJ4

The study of meaningful units involved in word formation is__________.
answer choices

Phonology
Pragmatics
Morphology
Morphemes

Answers

The study of meaningful units involved in word formation is morphology.

Morphology is the branch of linguistics that deals with the structure and formation of words. It is concerned with the ways in which words are constructed from smaller units called morphemes, which are the smallest units of meaning in a language. Morphemes can be combined in various ways to form words and to convey different meanings. For example, the word "unhappy" is made up of two morphemes: "un-" and "-happy." The morpheme "un-" means "not," and the morpheme "-happy" means "happy," so the word "unhappy" means "not happy."

Morphology is often studied in conjunction with other areas of linguistics, such as phonology (the study of the sounds of language) and pragmatics (the study of the use of language in social contexts).

learn more about Morphology:

https://brainly.com/question/15357845

Why do people change in relationships?

Answers

People change in relationships because relationship can't make due without exertion, arranging, and responsibility, they before long quit esteeming their accomplice.

People think their accomplice isn't their best match and that they might be more qualified for another person. Thus, they drop out of affection with their beau or sweetheart and fault the conclusion of the friendship on contradictions, wrong timing, and other irrelevant things.

You want to realize that couples lose sentiments in connections since they focus on things or individuals beyond their relationship and disregard the things that required the most consideration - the issues in the relationship. They fundamentally underestimate their relationship and spotlight on things they could do without about their accomplice. Thusly, they persuade themselves they need to leave and that they should be blissful.

To know more about relationships, visit here:

https://brainly.com/question/23752761

#SPJ4

Which group is most likely to vote ?

Answers

Answer: actavist

Explanation:

What does Squealer admit about Napoleon and the windmill Why do the animals accept this?

Answers

He sends Squealer to the animals to explain that the windmill was really Napoleon's idea all along and that the plans for it were stolen from him by Snowball.

What is meant by windmill?

In some English-speaking regions, the term "windmill" is also used to refer to wind pumps, wind turbines, and other applications. A windmill is a structure that uses sails or blades to convert wind energy into rotational energy in order to grind grain.Such machines are commonly referred to as wind engines.The horizontal windmill initially arose in Persia in the ninth century, while the vertical windmill first appeared in northwest Europe in the 12th century. Windmills were utilized throughout the high medieval and early modern periods. In the Netherlands today, there are about 1,000 windmills, which are regarded as symbols of Dutch culture.

To learn more about windmill refer to

https://brainly.com/question/12304307

#SPJ4

What is the importance of evolution?

Answers

Very important because evolution is what gives animals new adaptations to survive in the new season of the world like hard weather, same with us humans but we learn our way around that and know what to do, like tornadoes we stay inside, and if we’re cold we wear a lot of clothes

Is food contact surfaces a common vehicle of contamination?

Answers

In the food sector contact surfaces a common vehicle of hands may be the source of contamination most frequently.

In the food industry, hands are the most typical means through which contaminants spread from one location to another.Furthermore, the most typical utensil used when cooking meals is the user's hands. Food workers must constantly wash their hands to prevent.

The spread of infections, which is very important. Food handlers may also wear disposable gloves, but they must be replaced frequently.Hands are the main source of food contamination.They must frequently be washed. The main reason for this is because many people neglect to.

To know more about Contamination visit:

https://brainly.com/question/4376279

#SPJ4

What are the three 3 main purpose of the author in writing?

Answers

An author's purpose may be to amuse the reader, to persuade the reader, to inform the reader, or to satirize a condition.

Is the use of words and phrases that appeal to the 5 basic senses?

Answers

This is referred to as sensory language. In order to paint a clear picture in the reader's mind, sensory language employs words and expressions that appeal to the five senses (sight, sound, smell, taste, and touch).

Use of language that engages the five senses is it effective?Using language to evoke the five senses is a powerful strategy for captivating an audience and conjuring up vivid images.An author can give the reader a vivid mental picture of a scene or experience by appealing to their sense of sight, hearing, smell, touch, and taste.For instance, a novel set in a crowded metropolis would describe the flashing lights and frantic sounds of the streets.You may also add the rich aroma of freshly made coffee and the warmth of the sun on your skin.To make the city come to life, you may also add a bite of a salty or sweet snack.An author can make a scene more vivid and engaging for their readers by appealing to their senses.

To learn more about the use of words and phrases that appeal to the 5 basic senses refer to:

https://brainly.com/question/20116519

#SPJ4

Rewrite the sentence by correcting the error in pronoun reference or agreement.

Neither the Smiths nor Mr. Paulson remembered to purchase his hunting license.

Answers

Answer: Neither Smith not Mr Paulson remembered to purchase his hunting license.

Explanation:

You cannot use words like 'the' with names, names are itself a subject and no pronoun is to used before a name,putting your pronouns on your name tag, you're signaling how you want to be addressed..Only professional spaces like Mr. Mrs. Dr. etc is to be used before names.

Neither Smith not Mr Paulson remembered to purchase his hunting license. Because names are subjects in and of themselves, you cannot use words like "the" with names. By putting your pronouns on your name tag, you are indicating how you prefer to be addressed.

What is pronoun ?

A pronoun is a word that acts as a substitute for a noun, frequently to eliminate the need to repeatedly use the same noun. Pronouns, like nouns, can be used to refer to individuals, objects, ideas, and places. At least one noun or pronoun appears in most sentences.

A pronoun is a term that you use to refer to someone or something when you do not need to use a noun, frequently because the subject or object has already been named. The words "it," "she," "something," and "myself" are examples.

In order for us to speak with one another, pronouns are necessary. However, pronoun communication is really important. Next time, think twice before assuming that we refer to people by their pronouns when we identify or refer to them.

Thus, By putting your pronouns on your name tag, you are indicating how you prefer to be addressed.

To learn more about pronoun, follow the link;

https://brainly.com/question/7942658

#SPJ2

What is an example of Gothic?

Answers

Examples of Gothic literature include : Horace Walpole's The Castle of Otranto (1764).

Some historians assert that the 18th-century melodrama The Castle of Otranto by Horace Walpole served as the formal introduction of the Gothic style. Due to his fascination with ancient history, Walpole even built Strawberry Hill House, a mock Gothic castle, in 1749. The Frankenstein story has remained a recurrent presence in our society ever since Mary Shelley was inspired to write it on a stormy night.

In this timeless tale of man's folly in the pursuit of dangerous knowledge, scientist Victor Frankenstein seeks to play God by giving life to reanimated corpses. The Demise of the House of Usher narrates the tale of the house's fall and begins with the nameless narrator's arrival at Roderick Usher's remote home, where he believes he is still alive.

To learn more about Gothic Visit : brainly.com/question/1234077

#SPJ4

What does the fence symbolize in the story?

Answers

The fence seems completed exclusively in the last scene of the play when Troy passes on and the family reunites. The completeness of the wall comes to mean the strength of the Maxson family and unexpectedly the strength of the one who destroyed them, who additionally unites them once again, in death.

A fence is something that hinders you from something you need to accomplish or move past. Walls addresses limits, an illustration of this is when Troy and Cory get into an enormous battle, and Cory surrenders and tells Troy " Tell mother I 'll be back for my things." Cory then, at that point, says " It'll be over that wall".

Learn more about fence:

https://brainly.com/question/6531721

#SPJ4

How do you start a claim sentence example?

Answers

Typically, a claim statement is a thesis statement that includes a claim.

First, before you begin writing, make sure you have all the data and supporting proof available. For instance, wait until you have all the information necessary to support your viewpoint before submitting a claim statement for VA coverage, healthcare, or another type of insurance. Getting all the proof in advance can take a lot of work, but it will ultimately save you a lot of time and effort. Your claim may be delayed or rejected outright if you are unable to produce all of the supporting information at once.

Second, make sure your claim shows a clear relationship at all times. Don't just say that you were in a vehicle accident, that the other driver was determined to be at blame, and that you were injured when you file a claim statement following a collision. Instead, make it clear that the other driver's negligence caused the vehicle collision, which is how you sustained your injuries. The required connection for your claim is established by simply and concisely outlining these connections.

Third, think about asking a lawyer to analyses the case. An attorney can examine your claim to see whether it is legitimate and whether your claim statement is effective.

For more such question on Claim.

https://brainly.com/question/24143931

#SPJ4

How do you create an effective action plan?

Answers

An effective action plan is an important aspect of any successful project or endeavor. It outlines the steps you will take to achieve a goal and provides a timeline for these steps.

It also helps to ensure that all of the necessary tasks are completed and that resources are used efficiently. Creating an effective action plan involves considering the goal, developing a timeline, and identifying the resources needed to reach it. The first step in creating an effective action plan is to consider the goal. It is important to be clear and specific about what you hope to achieve. This will help to ensure that all of the steps you outline are relevant to the goal and that there is a direct path to achieving it. Once the goal has been clearly established, it is important to create a timeline for completing the tasks that are necessary to achieve it. This timeline should include dates for when certain tasks should be completed and how much time should be allocated for each task.

The next step is to identify the resources that will be needed to reach the goal. This includes any people, materials, or money that will be necessary, as well as any other resources that may be needed. It is important to ensure that all of the necessary resources are available and will be used efficiently. If resources are limited, it may be necessary to prioritize certain tasks and focus on the most important ones first.

Learn more about action plan at :https://brainly.com/question/28539621

#SPJ4

You may be familiar with origami, the Japanee art of paper folding but did you know that there are a variation, Called kirigami, which i involve both folding and cutting

Answers

Yes it's true that, Origami is a Japanese paper-folding technique that you may already be familiar with, but did you know that there is also a variety called kirigami that combines both folding and cutting.

The origins of origami can be traced back to the ancient Japanese art of paper folding. The technique is currently being practiced all over the world and is even being used to assist in the solution of technological issues. Origami, often known as paper folding, is the technique of folding paper into objects to create both two- and three-dimensional topics.

A 2D-to-3D transformation is made possible by the "folding" process in general origami, also known as paper-folding, which begins with a continuous flat object. Kirigami, also known as paper-cutting, on the other hand, combines both the "cutting" and "folding" procedures. Since the Edo era (1603–1867), when traditional Japanese origami first became popular, it has occasionally broken these rules by cutting the paper or beginning with shapes other than squares. Additionally, stents, packaging, and other engineering applications make use of origami concepts.

Learn more about Origami Visit: brainly.com/question/9254034

#SPJ4

Correct Question:

State true or false: You may be familiar with origami, the Japanee art of paper folding but did you know that there are a variation, Called kirigami, which i involve both folding and cutting.

Mrs. Bigelow graphed the inequality shown. She then writes four statements to model the inequality.

Answers

Four statements for modeling inequalities: Statement 4 does not model inequalities.

Which of the following values ​​is not in the solution set of the inequality statement? x+4≥1/2(x-3)

x + 4 > = 1/2(x - 3)

x + 4 >= 1/2x - 3/2

2x + 8 >= x - 3

2x - x >= -3 - 8

x>=-11

Therefore, numbers below -11 such as -11, -12, -13 are not included.

What is inequality?

It is defined as a mathematical formula that is unequal on both sides and has a lesser or greater mathematical sign than what is known as an inequality.

The figure shows an open circle that means the inequality is > or <

Closed circles represent "greater than or equal to" or "less than or equal to", while open circles represent less than or greater than. This number line has less than, greater than or equal values.

Learn more about inequality visit:

brainly.com/question/19491153

#SPJ1

Which academic vocabulary word is most related to central ideas?

Answers

Developed academic vocabulary word is most related to central ideas. The correct response is C. develop. The common academic vocabulary can be thought of as the language of the classroom and the test.

In written language as opposed to speaking, it is more useful. Moreover, we can quickly develop a more professional writing style with the use of basic academic vocabulary. For instance, when using a basic word like watch.

We would use observe in a general academic context. Additionally, a typical academic vocabulary example includes the primary idea of anything, which is why the ideal choice in this case is and the other three option nutrients, agriculture, and barter are incorrect.

Complete question:

Which academic vocabulary word is most related to central ideas?

A. learn

B. value

C. develop

D. blend

To know more about academic vocabulary visit:

https://brainly.com/question/24702894

#SPJ4

What is the figurative meaning of good fences make good neighbors?

Answers

The saying "Good fences make good neighbors" refers to respecting one another's property rather than literally meaning that fences make good neighbors.

What is a  good fences make good neighbors?Neighbors that get along well respect one other's property. Good farmers, for instance, maintain their fences to stop their cattle from straying onto neighboring farms. The poem "Mending Wall" by Robert Frost contains this adage.The adage "Good fences make good neighbors" succinctly captures the necessity for both clear property lines and for neighbors to uphold these lines if they want to maintain cordial and "good" neighborly interactions.Sometimes, good fences can create good neighbors. If, however, the neighbors concur that the barrier is either required or unimportant to them, they will cooperate in helping to build it. But we must remember that fences can often make very bad neighbors.

To learn more about good fences make good neighbors refer to:

https://brainly.com/question/19621629

#SPJ4

What are three facts about Great Zimbabwe?

Answers

Great Zimbabwe was inhabited from roughly 1100 CE to the 15th century, when it was abandoned. The city served as the seat of the Shona (Bantu) trading empire known as the Kingdom of Zimbabwe, "stone dwellings."

What merits Great Zimbabwe its notoriety?

A monument to the organization, independence, and economic might of the Shona peoples, Great Zimbabwe is one of the most highly developed cities in pre-colonial sub-Saharan Africa. For Zimbabweans in general as well as for the Shona, the location continues to be a strong symbol. One of sub-Saharan Africa's most stunning architectural landscapes has been called Great Zimbabwe. 1 Apart from the colossal Egyptian architecture, it is the largest stone edifice that was created in Africa before the modern age. The remaining ruins can be reached by car in four hours from Harare, the current capital of Zimbabwe. The Shona peoples lived there continuously until around 1450. It was built between the eleventh and fifteenth centuries (the Shona are the largest ethnic group in Zimbabwe). Great Zimbabwe, however, was by no means an isolated complex; at the height of its cultural development, it is thought that seven other nations in the area were equivalent to it.

To know more about Great Zimbabwe  visit:

https://brainly.com/question/11335960

#SPJ4

Should libero play left back or middle back?

Answers

Libero should play left back and not middle back.

A libero in inner volleyball is a back- row protective specialist. Since they only play in the reverse row, those players are frequently shorter than the front- row blockers and blockbuster but have impeccable ball- control chops. The position was created to promote ball- control.

Assuming that the strength of utmost opponents is attacking from the left side and you're running either a gyration or rover defense, your libero should be in the left back.However, also the libero should generally be in the middle-middle position, If you're running a middle-middle defense.

To learn more about Libero  here

brainly.com/question/29788141

#SPJ4

What happened in Tom Sawyer Chapter 5?

Answers

Tom pulls a box containing a "pinchbug," or a sizable black insect, out of his pocket because he is bored. At the same moment as a stray dog wanders into the chapel, the insect pinches him and escapes from his clutches to the center of the aisle.

Tom is sitting as far away from the windows and the outside as he can be, in the aisle. Widow Douglas and Willie Mufferson, the Model Boy, are among the town residents who enter. A bell, a hymn, lengthy announcements, and the minister's discourse signal the start of the service.

Tom is forced to whitewash the fence as punishment on Saturday after skipping class on Friday and getting into a brawl that left his clothes soiled. Tom initially feels let down by having to give up his day off. Corrie awakens to bombardment that evening. She sees her loved ones and friends being hauled away in a cart drawn by horses. The family learns that Holland has capitulated five days after the queen of Holland departs and tanks cross the border.

To learn more about Tom Sawyer Visit : brainly.com/question/22791698

#SPJ4

Please select the word from the list that best fits the definition.
Assessa. Analyzeb. Evaluatec. Questiond. Reflect

Answers

The word from the list that best fits the definition is B. Evaluate.

The phrase ASSESS way EVALUATE, and it's miles used with this which means in contexts including recruiting. When making use of for a job, the candidate is classified withinside the fields he noted in his resume. Moreover, the method of choice is normally called ASSESSMENT. While all these words mean "to judge something with respect to its worth or significance," evaluate suggests an attempt to determine relative or intrinsic worth in terms other than monetary.

Therefore, the correct option is B.

To learn more about assessment check the link below:

https://brainly.com/question/24690729

#SPJ4

Which animal is an allegory for communist propaganda?

Answers

Political Allegory:

Key figures in the Bolshevik leadership are represented by the pigs. Napoleon stands in for Joseph Stalin, Snowball for Leon Trotsky, and Squealer for Vyacheslav Molotov.

Summary of Animal Farm:

Animal Farm is a stinging indictment of the history and rhetoric of the Russian Revolution, which is why it is so well-known in the West. By narrating the development of Soviet communism via the stories of animals, Animal Farm allegorizes Joseph Stalin's rise to power. In the novella, the pigs quickly seize power after the democratic alliance of animals revolts against human tyrant Mr. Jones. Similar to how the Soviet elite did, the pigs establish themselves as the ruling class in the new society.

The battle for supremacy between Leon Trotsky and Stalin is represented by the conflict between the animals Napoleon and Snowball. In both real-world and fictional scenarios, the idealistic but politically helpless person (such as Trotsky and Snowball) is forced out of the revolutionary state by the vindictive and violent usurper of power (Stalin and Napoleon). The fabricated confessions and animal slaughter that Napoleon fears in Animal Farm after the windmill is demolished are a parody of the purges and mock trials that Stalin used to eliminate his opponents and solidify his support base. Stalin's dictatorial rule and ultimate rejection of the core principles of the Russian Revolution are represented by the pigs' transformation to violent dominance and adoption of human traits and behaviors—the trappings of their original oppressors.

For more such question on animal farm:

brainly.com/question/29617072

#SPJ4

Why is the day of calm and peace was called Halcyon?

Answers

November 27th because it is so so it
Other Questions
PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself?