How come the human body does not absorb water completely? In other words; why is it that even though the water could be the best possible in terms of purity, the kidneys still need to filter it? What is there to filter if the water is completely clean and pure? Shouldn't all that water simply be absorbed by all the cells in our organism?​

Answers

Answer 1

Answer:

Because it's job of kidney to filter out everything passing through it.

Explanation:

logical answer:

it's the job of kidney to filter every thing which oasses through it. How can your kidney know that the water you had drink is pure . Does your kidney have brain ?? likewise nothing is 100% perfect in this world , the water you drink is also not 100% pure.

Knowledgeable Answer:

Human body doesn't absorb all water completely because some water is filtered from our kidney to maintain overall fluid balance,to

regulate and filter minerals from blood, to

remove waste material and toxic substances. and it's the function of kidney to filter everything hich passe through it and if it stop filtering then human body doesn't work properly.

HOPE IT HELP ...... BUT VERY LONG SNSWER HAHAHA


Related Questions

Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?

Answers

The correct options would be B and E.

Variation in population size

The population size of each organism in different zones may not vary much due to the following:

Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.

More on adaptations of organisms can be found here: https://brainly.com/question/1686177

#SPJ1

3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true ​

Answers

Answer:

reproduction

Explanation:

different traits

One possible reason for the rise in the average air temperature at the Earth's surface is that

Answers

Answer:

cimate change

Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent

Answers

the correct answer is detergent which is not approved

The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.

What is a hand sanitizer?

Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.

Detergents are not approved during the formation of hand sanitizer.

Thus, the correct option for the given scenario is D.

For more details regarding sanitization, visit:

https://brainly.com/question/4296165

#SPJ2

Who establishes a crime scene?

options:

crime scene photographer

criminal investigator

first responder

district attorney

Answers

Answer:

first responders

Explanation:

no need for explaining

Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation

I'll give brainly to whoever response is good !
please help me :C

Answers

Answer:

At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.

Which feature of the ocean floor includes its deepest parts?

Answers

Ocean Trenches also known as Deep Sea Trenches

Which of the following is a natural resource for humans?

A-Cars
B-Electricity
C-Houses
D-Wood

Answers

D. Wood

Wood is a natural resource whereas everything else isn’t.

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?

Answers

Answer:

Some bacteria have mutated and are not killed by the penicillin

Explanation:

The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which

Answers

Fatty acid tails = hydrophobic
Phosphate heads= hydrophilic

You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.

Answers

A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

What are salinity and conductivity measurements?

Salinity is a measure of the salt content of a water body.

Conductivity is a measure of the electrical conductivity of a solution or substance.

Conductivity increases with increase in salinity.

An estuary is a region where salt water from the sea meet freshwater from a river or stream.

At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.

Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

Learn more about salinity and conductivity at: https://brainly.com/question/2472580

#SPJ1

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?

Answers

This is the complete question.

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor

in their work that could increase their chances of cancer?

A. Scientists who work with toxic chemicals

B.therapist who operate radiation machine

C.nurses who treat patients with viral infections

D.researches who study DNA replication

Research that study DNA replication. Thus, option "D" is correct.

What is cancer?

Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.

Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.

Thus, option "D" is correct.

To learn more about Cancer click here:

https://brainly.com/question/8590464

#SPJ1

Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?

Answers

The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.

What is Taxonomic classification system?

This is defined as the classification of organisms based on shared characteristics.

This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.

The complete question is:

Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.

Which of the following best explains why a standardized classification system is important to the scientific community?

Read more about Taxonomic classification system here https://brainly.com/question/11724129

#SPJ1


How might compound leaves and leaves with lobed margins be well-suited to windy environments?

Answers

Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

What is a plant adaptation?

A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.

Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.

In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

Learn more about plant adaptations here:

https://brainly.com/question/29594

#SPJ1

An organism that is eaten by a predator is

Answers

Prey is a term given to the organism that is eaten by the predators.

The backbone is also known as the vertebral column. Justify in accordance with both the
terms used

Answers

dont say babe lol is it bc i’m black no hehehe rawr im doing this so i can literally get answers for this thing

We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous

Answers

Answer:

We can mold metals into different shapes because they are _malleable__.

Explanation:

Malleable (ability to be hammered into thin sheets)

What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?

Answers

Answer:

Precipitation

Explanation:

Precipitation refers to a process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates.

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).

making nectar costs a plant energy because it uses up glucose that the plant has made. explain why the expense is worthwhile

Answers

Answer:

Nectar in flowers serves chiefly to attract pollinators, such as fruit-eating bats, hummingbirds, sunbirds, and insects. Nectaries are usually located at the base of the flower stamens, which draw animal visitors into contact with the pollen to be transferred.

Explanation:

10 points!

A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.

Answers

Answer:

it’s a spore

Explanation:

it should be a spore. It’s because the spore is the haploid.

PLEASE HELP PLEASE
Do you think this is a good way to eliminate invasive species from an ecosystem? Do you think the risks of the gene drive getting into another species are worth gaining biodiversity in an ecosystem? Explain your opinion.

Answers

Use of bioagent is a good way to eliminate invasive species from an ecosystem.

What is a good way to eliminate invasive species from an ecosystem?

In my opinion, to eliminate the invasive species from an ecosystem we should find out its bioagent instead of chemical spraying because bioagent does not adversely affected the environment.

The risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem because it leads to many consequences and unpredictable effects on ecosystem.

So we can conclude that use of bioagent is a good way to eliminate invasive species from an ecosystem.

Learn more about invasive here: https://brainly.com/question/1542287

#SPJ1

Yes, it is a good way to eliminate invasive species from an ecosystem. This is because invasive species play a critical role in the limitation of biodiversity of a particular ecosystem.

What is Biodiversity?

Biodiversity may be defined as the sum total of all the variety of living organisms in a particular ecosystem.

No, the risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem. This is because it directs considerable influences and unanticipated impacts on the ecosystem.

Therefore, it is well described above.

To learn more about the Ecosystem, refer to the link:

https://brainly.com/question/26551655

#SPJ1

What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional

Answers

Answer: (directly proportional)

the reason is the because the meaning of directly proportional is one increasing & decreasing at different rates. when a population takes resources the population grows but the resources sink but not in the same rate unless it would be inversely proportional if the population was increasing and decreasing at the same exact time as the resources

What factors can limit growth?

competition
amount of sunlight or water
r-selected species
geographic borders

Answers

The answer is

Amount of sunlight or water.

As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.

learn more things about what factors growth

https://brainly.com/question/3944507

Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?

A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers

Answers

Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.

How, explain your answer briefly?

The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds.

The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

Thus, option "D" is correct.

To learn more about salmons click here:

https://brainly.com/question/16208604

#SPJ1

4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.

Answers

Answer:

A is the answer

Explanation:

please mark me as brainlist

what would most likely happen if a person increased the amount of saturated fat in his or hers diet?

Answers

Answer: If a person increased the amount of saturated fat in his or her diet there is a chance of risk of cardiovascular disease would increase.

Explanation: Increase in the amount of saturated fat in diet results in the increase of levels of cholesterol in blood. This cholesterol is in the form of LDL.

If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.

What is the harmful effect of saturated fatty acids?

Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.

Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..

Learn more about the harmful effects of saturated fatty acids here.

https://brainly.com/question/14118324

#SPJ2

how can global warming lead to changes to the Earth's surface?

Answers

Answer:

It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.

Economic importance of tilapia fish

Answers

Answer:

Tilapia is one of the most productive and internationally traded food fish in the world. The production of farmed tilapia is among the fastest expanding food sectors in the world. Nile tilapia ( Oreochromis niloticus) is the most cultured freshwater species among the farmed tilapia and contributes about 71% of the world total tilapia production.

Tilapia is one of the most important farmed fish species worldwide (FAO 2018) and an important source of protein (Fitzsimmons 2000;Hai 2015). Due to its sequenced genome (Conte et al. 2017), easy reproduction, efficiency in adapting to diverse diets, high resistance to diseases and handling practices, and high tolerance of a wide variety of husbandry conditions, it is considered an ideal model in toxicological research.

Explanation:

I hope it helps

Other Questions
Given the function h(x)=-5 x, which statement is true about h(x)? The function is decreasing on the interval (, 0). The function is increasing on the interval (, 0). The function is decreasing on the interval (0, ). The function is increasing on the interval (0, ). Which law of thermodynamics relates most directly to the Law of Conservation of Energy? A four-sided shape has four congruent angles and sides. Which quadrilateral could it be? A. quadrilateral B. trapezoid C. square D. parallelogram My opponent in this race for the governor's office claimsthat I am corrupt. He dares to suggest that I acceptedfavors from business owners inexchange for putting themin contact with state legislators who lowered businesstaxes. This is an absurd claim. Moreover, find it ironic thathe, of all people, wants to point fingers and talk aboutcorruption. Isn't it interesting that he accepts so manycampaign donations from the oil industry and is single-handedly responsible for sponsoring state laws that easeenvironmental regulations? Dear friends, remember onElection Day who the real honest politician is in this race.It's certainly not the man on the other side of the aisletrying to distract us from his own bad character.Which statement best describes the speaker's point of view? Nico is brainstorming reasons to support this claim for his argumentative essay.Bob Dylan deserved to win the Nobel Prize.Which reasons would be the most effective? Select two options.Dylan has been internationally acclaimed for more than half a century.Dylan is first and foremost a poet, and poetry is often accompanied by music.The effect of Dylan's music on his listeners and fans has not always been positive.It has been almost a quarter century since an American won the Nobel Prize in Literature.True poetry does not require music to be effective, but Dylan's lyrics work only when put to music. I dont understand how to solve this question, can I have an explanation? I will give Brainliest. (1/7x + 3/8) + (2/9x - 1/8) Consider triangle ABC. What is b? The endpoints of wx are w (5,-3) and x (-1,-9) what is the length of wx ? PLSS HELPP!!! 100 POINTSS!! write a three-paragraph mini essay on the following prompt. Each paragraph must be from 5 to 7 sentences. Include one example of a simile, a metaphor, and a hyperbole that you circle. Also, underline your thesis statement. Prompt: Do you think Julius Caesar in the play, Julius Caesar should have been murdered, and do you think he was too ambitious? Provide evidence from the play to support your answer. How can evidence from an experiment be explained in relationship to the hypothesis?as a predictionas a questionas an inferenceas a conclusion A weather balloon is partially inflated with helium gas to a volume of 2.0 m. The pressure was measured at 101 kPa and the temperature at 27 C. What will be the new volume if the balloon is when it moves upwards to where the atmospheric pressure is 40 kPa and the temperature is at 10 C? Which ecosystem has the least biodiversity? (1 point)O cornfieldO prairieO rain forestO coral reef -6y+y2+3-4y2-7+1-4y Please help how to plot and graph y1 = 17,105 + 1.31x 9x10^2 which sentence matches the question assigned Please help me answer this Where does the Secretary of State rank among the President's cabinet? The division between the North and the South in the 1800s can best be described as 3 x 7/12 do not simplify pls