Answer:
bok choy
Explanation:
bok choy is causing pollution
brainly plz
Answer:
hehe i just finished answer a question about pollution sooo here you go :) this is just an example and not a full essay I recommend adding more evidence!! (please write in your own words)
Pollution has been a problem for over 2,000 years now. There are many things that are causing pollution. For example firecrackers!
Using firecrackers can be very dangerous not just for us, but the environment as well. Firing crackers can increase the concentration of dust and pollutants in the air. After firing, the fine dust particles settle on the surrounding surfaces which are packed with chemicals like copper, zinc, sodium, and lead. Now you may think oh so it's bad for the air so what? If the air is polluted, trees and plants that give us oxygen can't do their job. If they can't do their job we can't breathe or live. Most of the chemicals that are bad for the air are in firecrackers. These chemicals can last for hours or days on end, exposing you and your neighbors to possible long-term health problems. Then fireworks also have the potential of starting wildfires. About 7,500 to 10,600 trees were burnt down (10% to 14% of trees) in California alone due to wildfires. About 19,500 trees were burnt down just from fireworks.
give example on substitutions for frieworks. I would recommend adding more information about how the chemicals in the firecrackers are dangerous for the air. Since I didn't go into full enough details (if you don't you might get marked down for not having enough details or evidence)
what do you call an organism that has been genetically engineered to contain a gene from a different species?
Answer:
A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.
Explanation:
Answer:
This would be called a transgenic or genetically modified organism.
Explanation:
A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.
nucleic acids are assembled in the _____ direction.
Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.
What are Nucleic acids?Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.
Learn more about Nucleic acids here:
https://brainly.com/question/11309892
#SPJ6
what insects are sometimes called devil’s darning needles?
hii everyone i have question again which substances made gages
What is the question???
How is the word Representation used in a sentence
Answer:
A graphical representation of results is shown in figure 1. 17. He gave a talk on the representation of women in 19th-century art. ... He is writing a book on the representation of woman in medieval art
74 POINTS!!!!
How could addressing market failure help make an economy more environmentally sustainable?
Answer:
If companies are held accountable upfront for the consequences their actions will have on the environment, their actions may be more environmentally friendly from the beginning.
What are characteristics that are unique to wetlands?
Answer:
Wetlands must have one or more of the following three attributes: 1) at least periodically, the land supports predominantly hydrophytes; 2) the substrate is predominantly undrained hydric soil; and 3) the substrate is saturated with water or covered by shallow water at some time during the growing season of each year.
Explanation:The minimum essential characteristics of a wetland are recurrent, sustained inundation or saturation at or near the surface and the presence of physical, chemical, and biological features reflective of recurrent, sustained inundation or saturation.
why are the larval stages of silk moth and honey bees voracious ? please fast answer me
Answer:
Since that stage is the stage that most of their growth occurs and nutrition is important for their growth. Thus they eat continuously to sustain the growth pattern.
21. Three different processes are occurring in the drawing below. Name each process and describe it.
Answer:
Process A is diffusion
- diffusion is the random movement of molecules from the area where there is more of them to an area where there is a few of them without the input of energy.
Process B is facilitated diffusion
- facilitated diffusion is the transport of substances across a cell membrane from an area of higher concentration to a lower concentration with the help of Transport protein
Process C is active transport
- A ctive transport is when an input of energy is required to move materials through a cell membrane .
Whales and hippos are thought to have evolved from a common ancestor around 54 million years ago. Which of the following is also true about these species?
Answer:
Both whales and hippos have almost no hair on their bodies. They do not have sweat glands.
Explanation:
easy question - giving brainly if correct !!
Answer:
i think its C
Explanation:
i would go with c
name a difference between a plant cell and an animal cell.
Answer:
the cell wall, chloroplasts
Explanation:
plant cells have a cell wall, but animal cells do not
plant cells also have chloroplast, but animal cells don't
what is the creatinine level for stage 3 kidney disease
Explanation: Stage three: For Kidney disease patients whose serum creatinine level is in the range 178-442 umol/L, their GFR usually fluctuates in the range 30-59ml/min/1.73m2 which means kidney function has a moderate decrease.
Hope this helped u, please mark me as Brainliest
How are male and female reproductive organs similar?
Answer: They are the same in that most of the reproductive organs of both sexes develop from similar embryonic tissue, meaning they are homologous. Both systems have gonads (male have testes and female have ovaries) that produce gametes (testes produce sperm and ovaries produce egg or ovum) and sex organs.
Machines known as “DNA synthesizers” can produce short pieces of DNA.
True or false
Answer:
Machines known as DNA synthesizers are used to produce short pieces of DNA, up to several hundred bases in length. These synthetic sequences can then be joined to natural sequences using DNA ligase or other enzymes that splice DNA together. A gene from one organism can be attached to the DNA of another organism.
quién me ayudaría a hacer este crusigrama
gracias
Answer:
Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:
Explicación: 1.Venezuela
2. Sanclemente
3. Marroquin
me das corona plis chau
Explanation:
all female mammals have one active x chromosome per cell instead of two. what causes this?
Answer:
maybe its because of pregnancy
Explanation:
How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)
Answer:
A
Explanation:
the age of a woolly mammoth can be determined by examining what?
Answer:
examining the tusks, bones, teeth, (carbon levels in tissues depends)
Explanation:
Carbon-14 can be used to date the remains of dead organisms because all living things use carbon to build tissue.
The biological age of mammoths (also known as the "age at death") is usually estimated by comparison to correlations between the biological age and the wear stages of grinding teeth in extant elephants. As tusks grow, they continually incorporate ingested strontium (Sr), and the incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to investigate proboscidean movements
scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends)
What are Mammoth?All living things need carbon to create tissue, making carbon-14 a useful tool for dating the remains of deceased species.
Mammoths' biological age, also known as the "age at death," is typically calculated by comparing it to correlations between that age and the phases of tooth wear in living elephants.
The incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to study proboscidean movements as tusks continuously integrate ingested strontium (Sr).
Therefore, scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends).
To learn more about Mammoth, refer to the link:
https://brainly.com/question/24163999
#SPJ2
why are cells growing on top of each other even if they have space in culture flask
Answer:in culture plates cell density of the edges is often more than the center of the dish,
what causes this distribution?
Explanation:
how can an understanding of osmosis be important in developing methods for the same storage of food?
Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.
what does the doctor inject into the child to make the child immune to measles
Answer:
MMR vaccine
Explanation:
CDC recommends that children get MMR vaccine to protect against measles, mumps, and rubella.
#5 and 6 pleasee I will give you 100 points
6)it is bigger then we ever thought and that we wont beable to explore it all..
CORRECT ME IF I AM WRONG
6) it is bigger then we ever thought and that we wont beable to explore it all
sorry if this didnt help
what is occurring during the s phase of the cell cycle?
what is the role of microfilaments in cell division
Answer:
. Microfilaments help the cell lay down new membrane and divide into two daughter cells.
Explanation:
skeletal muscle exhibits alternating light and dark bands called
Skeletal muscle exhibits alternating light and dark bands called a sarcomere
Skeletal muscle is having sarcomere having myofibrils which appear dark and light in the microscope.
What is skeletal muscle?Only thin filaments containing actin are present in isotropic bands, anisotropic bands are the darker bands (A bands).
Repeating sarcomere sections, which are visible under the microscope as alternating dark and light bands, make up myofibrils.
When a muscle contracts or relaxes, long, fibrous protein filaments called sarcomeres glide past one another. Because of this, skeletal muscle is also known as striated muscle.
Therefore in appearance due to myofibrils composed of the sarcomere look light and dark bands in the skeletal muscle under a microscope.
Learn more about skeletal, here:
https://brainly.com/question/29215804
#SPJ2
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
Which of the following refers to the transformation of stimulus energy into neural impulses?
A) Perception
B) Bottom-up processing
C) Top-down processing
D) Transduction
E) Psychophysics
The conversion or the transformation of the stimulus energy into the neutral impulses is know as transduction referring to the five senses. The perception s the process that leads tp the stimulus energy into the neutral impulses.
For example the hue or color and its dimension are determined by the wavelength of light that is perceived.Hence the option A is correct.
Learn ore about the refers to the transformation of stimulus.
brainly.com/question/18958345.
is coloration an important factor in successful predation? Why?
Answer:
Yes and No....
Explanation:
Because color determines whether or not the predator will see its prey since the prey might be able to camouflage into it's surroundings.
So I guess this helps-hopefully-uh hope you have a good day bro-
Explain your observations. What did you observe as you added phenolphthalein to the ammonia solution? What did you observe when vinegar was added?
Answer:
Liquid ammonia is liquefied ammonia and is basic in nature. It dissolves in water to give ammonium hydroxide which ionizes to give hydroxyl ions. Therefore it turns red litmus blue and phenolphthalein solution pink.