If a diploid eukaryotic cell contains 14 pairs of chromosomes for a total of 2n=28, how many chromosomes will be in the resulting products of cellular division if the cell undergoes:
Mitosis?
Meiosis?

Answers

Answer 1

Answer:

Mitosis = 28 chromosomes

Meiosis = 14 chromosomes

Explanation:

- Mitosis is the type of cell division in which the daughter cells are genetically identical to the parent cell and possess the same number of chromosome as the parent cells. For example, a diploid parent will produce a diploid daughter cell after mitosis.

- Meiosis, on the contrary, is the cell division that produces daughter cells that are genetically different from the parent cell. Each daughter cell have a reduced number of chromosomes (by half).

According to this question, a diploid eukaryotic cell contains 14 pairs of chromosomes i.e. 2n=28. After mitosis, each daughter cell will have same 28 chromosomes as the parent cell. Meiosis on the other hand, will produce daughter cells that possess 14 chromosomes each.


Related Questions

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland

Answers

Answer:

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.

The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

What do you mean by Endocrine Gland?

An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.

The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.

For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.

Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

To learn more about Endocrine glands, refer to the link:

https://brainly.com/question/4455660

#SPJ2

Help ASAP, please
Thank you, Friends:)

Answers

irieirirkekeksksekekekekdjdjdjdkdkskdkdjdj

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

how is zero, oxidation numbers, and noble gases related​

Answers

Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.

hope this helps

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

50 POINTS !!!!A credit union is a business that is owned by people who have something in common, offers you a place to keep your money, and uses your funds to make more money. A. True B. False

Answers

Answer:

true

Explanation:

Hope this helps

Answer:

The anser is FALSE

Explanation:

I just took the test and it was FALSE

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle

Answers

Answer:

inner core

Explanation:

I looked it up

Help stepbro im stuck in the washer

Answers

Answer:

I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT

Select the statement(s) that is accurate about the immune system.

Answers

What’s the statements


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species

Answers

C. beneficial to the ecosystem

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

Which factor listed below is abiotic? Bacteria, water, fungi, protists

Answers

Answer:water

Explanation:

Answer:

Water

Explanation:

Water does not contain cells, therefore it is non-living.

Select the correct answer.
Which type of galaxy is the Milky Way?
A.
elliptical
✓ B.
spiral
C.
irregular
D.
lenticular
Next

Answers

Correct answer is B. Spiral

Explanation:
Answer provided by www.amnh.org

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False

Answers

I’m pretty sure it’s true. It makes the most sense.

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D
Other Questions
What is number line class 6? Which of the following statements about erythropoietinis true?a. It facilitates the proliferation and differentiation of the erythrocyte lineage.b. It is a hormone produced by the thyroid gland.c. It is a hemopoietic growth factor that prompts lymphoid stem cells to leave the bone marrow.d. Both a and b are true. Which factors affect the development of the florida peninsula? check all that apply. What is a common response to the proliferation and geographical interpenetration of religions? At time t=0s , an object is moving to the right with a velocity v that can be modeled by the equation v=(4. 2 m/s)-(1. 4 m/s2)t. At what time, if any, does the object change its direction of motion?. You are traveling to Thailand on a business trip. Your laptop's touchscreen display is visibly flickering when plugged into the power outlet at a local coffee shop. You take your laptop to your hotel room, and you notice it doesn't flicker when plugged in there. Which of the following is the MOST likely cause of this issue? What does Article 2 of the Code of Ethics prohibit? Which structure is highlighted? vestibular membrane spiral organ nerve fibers of cochlea basilar membrane tectorial membrane express the boolean function, draw the logic diagram and calculate the gate input costs a. using only and and invert operations: b. using only or and invert operations: c. which logic diagram has the lowest gate input costs? How do I verify my Selective Service registration without social security number? Which is better Agile or Kanban? Mira and Marie sell computers. Last month Mira sold 16 more computers than Marie. Together they sold 56. How many computers did Marie sell? A PBX/PABX has seven telephone channels to a public exchange.During the busy hour on average 3.4 lines are occupied (a) what is the traffic intensity during the busy hour? Which of the following is conveyed by an assertion? With Biogeographical evidence we know that animals spread and did what to their environments to enhance survival? in the united states during the late twentieth century, internal migration streams were moving people from When I was working for this company ............. to the other side of the city, it was very inconvenient. Use the scale to help you solve the equation and find the value of x. Enter thevalue of x below.x+9=13X= Consider the labor market for hairstylists in two small towns, each with only one hair salon, such that the owners of the salons have monopsony hiring power for hairstylists. The following graphs depict the labor supply, marginal expense (M, or more generally, marginal resource cost, MRC) of labor, and labor demand in these markets. What is the discriminant of 3x2 5x =- 4?