15. I
16. G
17. C
18. A
19. H
20. F
21. J
22. B
23. D
24. E
If this answer helped you, please feel free to give thanks and rate! <3
explain why the concentration of FSH in the blood increases after day 1
Answer:
As the levels of FSH and LH in the blood increase with puberty, the eggs begin to mature and a collection of fluid — the follicle — begins to develop around each one. The first day of menses is identified as cycle day one. Estrogen is at a low point. ... This increase in estrogen begins to inhibit the secretion of FSH.
Explanation:
50 POINTS !!!!A credit union is a business that is owned by people who have something in common, offers you a place to keep your money, and uses your funds to make more money. A. True B. False
Answer:
true
Explanation:
Hope this helps
Answer:
The anser is FALSE
Explanation:
I just took the test and it was FALSE
Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle
Answer:
inner core
Explanation:
I looked it up
Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids
Answer:
The correct answer is - proteins.
Explanation:
All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.
Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.
Describe the steps a plant would take to move sugars from a source to a sink.
*15 points* Earth Science
Based on the picture, how many tilting events has this area undergone, and which principle tells us that this area has undergone tilting?
Select the correct answer.
Which type of galaxy is the Milky Way?
A.
elliptical
✓ B.
spiral
C.
irregular
D.
lenticular
Next
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland
Answer:
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.
The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
What do you mean by Endocrine Gland?An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.
The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.
For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.
Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
To learn more about Endocrine glands, refer to the link:
https://brainly.com/question/4455660
#SPJ2
Help ASAP, please
Thank you, Friends:)
how does a liver cell respond to insulin
Answer:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
Explanation:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
I need help with this thank you
Answer:
A).
Explanation:
Universe > Galaxy > Solar Sytem > Earth
Which factor listed below is abiotic? Bacteria, water, fungi, protists
Answer:water
Explanation:
Answer:
Water
Explanation:
Water does not contain cells, therefore it is non-living.
Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Answer:
The correct answer is -
a single strand with a distinctive cloverleaf structure, and
tRNA
Explanation:
The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.
Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.
Jim observes that his pet lizard is more active on warm, sunny days than at night or during rainy days.
Which statement is the most valid hypothesis he can make from this observation?
Lizards are more active when they feel more comfortable.
Lizards like warm temperatures.
O If the temperature increases, then lizards become more active.
If the lizard is active, then the temperature must be cool.
Answer:
If the temperature increases, then lizards become more active.
Explanation:
Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks
Answer:
Bacteria
Explanation:
Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.
Sunlight, rocks, and soil are all non-living.
The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.
They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.
Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.
Learn more about soil at:
https://brainly.com/question/31227835
#SPJ6
If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False
how is zero, oxidation numbers, and noble gases related
Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.
hope this helps
Question 2 (1 point)
Which two vocabulary words are synonyms (meaning similar things)?
a
revolution
b
orbit
c
latitude
rotation
Answer:orbit and rotation
Explanation:
Which of the following options best depicts the flow of information when a gene directs the synthesis of a protein?
protein>RNA>DNA
RNA>DNA>RNA>protein
DNA>RNA>protein
DNA>tRNA>mRNA>protein
Answer:
DNA → tRNA → mRNA → protein.
Explanation:
I believe that the above given option should depict the flow of information when a gene directs the synthesis of a protein.
What is natural selection
In a paragraph
This is for 8 grade but can someone help me
Answer:
Natural selection is a pressure that causes groups of organisms to change over time. Animals inherit their genetics from their parents or ancestors, and the environment is constantly changing.
Explanation:
(self-explanatory)
What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%
Answer:
90%
Explanation:
Explain the differences between Bacteria and Decomposers?
Answer: Decomposers like bacteria and fungi don't eat their food, they decompose it externally. Also, decomposers consume nutrients on a molecular level while detritivores eat large amount of decaying material and excrete nutrients. ... In addition to fungi, bacteria are also decomposer organisms. brainliest
Explanation:
What can be concluded from the graph?
The layers of Earth have different densities.
O P and S waves are absorbed in the core.
The layers of Earth do not have distinct boundaries.
O Pand S waves always originate in the mantle and travel through the core.
Answer:
Explanation: second option
"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"
Answer:
b is the answer my friend. hope this will solve your problem. mark me as brainliest
It is difficult to observe individual chromosomes
with a light microscope during prophase
because
A. The DNA has not been replicated yet
B. They are uncoiled, in long, thin strands
c. They leave the nucleus and are dispersed to
other parts of the cell
D. The spindle must move them to the metaphase
plate before they become visible
Answer:
I think the answer is B They are uncoiled, in long, thin strands
The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species
If the base sequence of a strand of DNA is ATGGGCCTA, what would be the base sequence of the complimentary DNA strand?
Answer:
TACCCGGAT
Explanation:
Adenine(A) always base pairs with Thymine(T) (except in the case of RNA, in which case A would base pair Uracil(U).
Cytosine(C) always base pairs with Guanine(G).
Help stepbro im stuck in the washer
Answer:
I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT
Select the statement(s) that is accurate about the immune system.
Laying eggs belong to which category of energy use? Maintenance, waste production, movement, growth and reproduction
Answer: it is reproduction
Explanation: