The best circumstance for uncovering her true biases is questioning each individual in the judge's chambers.
Voir dire is a legal term for a number of jury trial-related proceedings. Originally, it was a promise to tell the truth made by jurors. In some jurisdictions, the procedure of jury selection is also referred to by this informal phrase.
Generally speaking, voir dire is structured as follows:
Prospective jurors are chosen at random from a group of people who report for jury service.
To make sure everyone is qualified to serve on a jury, the judge conducts routine interrogations.
Following the exclusion of those who are ruled unable, attorneys present a brief opening statement that summarizes their argument.
Both attorneys then interview the remaining potential jurors to ascertain prejudice after the mini-openings.
To know more about jury, visit:
https://brainly.com/question/28666968
#SPJ4
Which of the following is considered a risk of driving?
A. Spending too much on gas
B. Getting lost
C. Causing damage
What is the governments role
Answer:to do take care of the people
Explanation:
examination of bill of entry is done to vouch
Answer:
What? I Don't understand
Explanation:
Essay on civil and criminal laws on malaysia?
Answer:
are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.
Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.
Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences
Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.
Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.
Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.
A mixed legal system is a mixture of two or more legal system practised by some countries.
2.0 Malaysia’s Legal System
Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.
laws pertaining to persons professing the religion of Islam.
Share this:
Cite This Work
To export a reference to this article please select a referencing stye below:
OSCOLA
APA
MLA
MLA-7
Harvard
Vancouver
Wikipedia
All ltd, 'L
Trustedsite Law
19. To bring a derivative suit, a shareholder must own stock at the time of the
A. injury and at the time of the suit.
B. injury only
C. suit only
D. trial, suit, and injury
Answer:
A. injury and at the time of the suit.
Explanation:
A corporation can be defined as a corporate organization that has facilities and owns or controls assets used for the production of goods and services in at least one country other than its headquarter (home office) located in its home country.
This ultimately implies that, a corporation is a corporate organization that owns or controls its business in two or more countries.
One of the advantage of a corporation is that, owners have limited liability for debt to the extent to which they have invested and as such are not personally liable for some of the debt owed by corporation.
A derivative suit can be defined as a lawsuit that's brought forward by a shareholder on behalf of a corporation, to either defend or enforce a legal right (claim) against a third party such as a director or executive officer in the corporation.
Hence, to bring a derivative suit to a court of competent jurisdiction, a shareholder must own stock at the time of the injury and at the time of the suit.
The primary job of the legislative branch is to
Answer:
The legislative branch drafts proposed laws, confirms or rejects presidential nominations for heads of federal agencies, federal judges, and the Supreme Court, and has the authority to declare war.
Explanation:
Hope this helps and have a wonderful day!!!
____ and ____ are the two forms of contracts.
Answer:
fixed price contracts and cost-reimbursement contracts
How does Levi from aka help better understand the government
Answer:
By making it better for others
Explanation:
While the U.S. Constitution initially gave most of the responsibility for foreign affairs directly to the President, what is the name of the separate Department that was established within the executive branch to handle U.S. foreign relations?
Select one:
A. Commerce
B. Treasury
C. State
D. Homeland Security
You want to work in the court, and you have just heard that most cases that come across a prosecutor’s desk never go to trial. What are your options? One of the prosecutor’s jobs is to work with law enforcement officials. Larger offices, as in New York, do tend to have larger cases with more opportunities. Drop the idea of becoming a prosecutor. Learn what other tasks prosecutors do in particular offices or agencies.
multiple choice
Common law originated from custom and use rather than from written statutes. While American law is based on custom, most jurisdictions have now codified their criminal law via statute and legislation.
What can people do if they feel that a law is unfair?
Answer:
Get them to sign petitions and contact their legislators. If you created a Web presence for your grassroots group, be sure to let your customers know how they can follow you on social media for the latest updates. Additionally, seek other organizations that might have a stake in defeating unfair laws.
Explanation:
Also, while the law is being passed on through all 3 branches the law must go to a vote. Therefore, if you believe the law is unfair you can vote against it.
Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!
Which question would best be answered by studying an area’s social structure?
A.
Why are crime rates higher in that area than another area?
B.
Why are most crimes committed by men?
C.
Why do crime rates rise during the hottest part of the summer?
D.
What type of personality is more likely to commit a crime?
Answer:
I think it's option (A) Why are crime rates higher in that area than another area?
Answer:
a
Explanation:
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
Which of the following is a belief held by the theory of natural law?
what is the example of red lie?
red lie are lies to harm others
Explanation:
example:
Danice: Mr William Jake took your phone and smashed it on the ground
Mr William: What?
* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*
Hope it helps
A claim made with full knowledge that the opposing person already knows it to be untrue.
What is a red lie?Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.
An example of a red lie will is:
Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a red lie that is presented.
Learn more about red lie, here:
https://brainly.com/question/25427223
#SPJ2
A polygraph test is conducted, and the findings indicate that there is an 80 percent chance of deception. What does this mean for the investigation?
a) The suspect is guilty and should be arrested for the crime.
b) The suspect is probably just nervous since 80 percent is a pretty high number and usually indicates a false positive.
c) The suspect might be guilty, but more information is needed from other parts of the investigation.
D)There has been a mistake in the polygraph test, and the test should be conducted again to get better results.
Answer:
c
Explanation:
Who is most likely to follow public opinion polls to help them make decisions? Members of the House of Representative, Senators or the President? Why?
Answer:
The President is the one who is most likely to follow opinion polls when making government decisions, given that it is a one-man and clearly personalist position, which means that, in case of making decisions that are contrary to the majority opinions, it will impact decisively in its political image in the face of society. On the other hand, both the Senate and the House of Representatives are plural organisms, with which their members are less individualizable and, therefore, are less exposed to public opinion.
Answer:House of Representative members
Explanation:
Representatives run for election every two years and must constantly raise campaign money. They abide by public opinion because do not have time to explain their actions or mend fences before each election.
What is element identification in the legal practice?
Answer:
this is what I found online:
"Element Identification is a helpful skill to decide what action is needed…… (IE levels of research via sources and or investigation.) By taking each legal situation and breaking. From this point you may begin identifying the. legal issue of the complaint/case."
John sold a pair of skis to Bob, making no specific warranties or promises of any kind other than letting Bob examine and try them. In fact, John did not own the skis; he had only rented them. When the true owner claimed them, Bob demanded his money back. John defended his actions by stating that he had made no warranty of any kind.
What is a permanent feature if a representative form of government?
Answer:
Elections
Explanation:
I would guess that elections are what make a representative form of government actually representative. Without elections, the ones in power would not actually represent the views of the people.
In a violent culture, the level of “background violence” is _____.
Group of answer choices
Answer: Violent culture is associated with social disputes.
Explanation:
In a violence culture the background violence includes the reason for violence. It can be because of lack of literacy, stress, financial crisis, family and neighborhood dispute, domestic dispute, jealousy, criminal conduct, argument, racial discrimination, abuse of powers, alcoholic aggressive behavior and disputes, social injustice, gender discrimination, and other reasons. These reasons promotes the violent culture.
What did Roosevelt believe was the purpose of government?
What is the first step to reducing risk in the highway transportation system?
A. The first step is to understand what are the risks.
B. The first step is to understand what traffic signs mean.
C. The first step is to understand when to brake.
The rights of people accused of a crime are protected in the Bill of Rights. Choose ALL true statements about how the Bill of Rights protects the rights of the accused.
A) Punishment for a crime must be fair and appropriate.
B) People accused of crimes can choose their own juries.
C) Searches and seizures of people's property must be lawful. Eliminate
D) Trials must be fair and speedy, and include a jury of peers.
E) Under no circumstances is a person's property to be searched.
Answer:
B, C and D
Explanation:
C is Protection from Unreasonable Searches and Seizures ( amendment 4)
D is- Rights of Accused Persons in Criminal Cases (Amendment 6)
B is- public trial by an impartial jury (amendment 5)
A is not covered under the BoR
E: you can be searched if there is probable cause
Answer:
the answer is a, c, and d
Explanation:
PLEASE ANSWER WILL GIVE MOST BRANLIST WHO ANSWER CORRECT!!
(NO LINKS)
Which of the following aspects of the article is NOT thoroughly discussed?
A
how new amendments can be ratified
B
why support for the ERA diminished
C
how gender discrimination affected women
D
why some people chose not to support the ERA
A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.
Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35
Answer:
It is C.30 years old
Explanation:
What can people do if they feel that a law is unfair?
Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
What is the default join type?
Answer:
If this is for edge....it’s A) inner
Explanation: