Part C
Calculate the ratio of the lengths of the two line segments formed on each transversal. You will have two sets of calculations. Round your answers to the hundredths place. What do you notice about the ratios of the lengths for each transversal? How do they compare?

Answers

Answer 1

Answer:

Line segment PM = 4.2 length

ML = 6.2

ON = 3

NK = 2

Step-by-step explanation:

Just got it on plato your welcome:)

Answer 2

The segments formed by each transversals and the three parallel lines are

proportional according to the three parallel lines theorem.

The observations are;

The parallel lines divide the transversals in equal proportions, such that the ratio of the lengths of each transversal are equal.

[tex]\displaystyle \mathrm{ Ratio \ of \ the \ segments ;\ }\frac{\overline{CB}}{\overline{AB}} = \frac{\overline{EF}}{\overline{DE}}[/tex]

Reasons:

The question is a four part question

Let the equations of the parallel lines be as follows;

Line, x; y = x

Line, y; y = x + 1

Line z; y = x + 2

The points at which transversal 1 intersect the lines x, y, and z, are;

A(0.4, 0.4), B(0.6, 1.6), and C(0.8, 2.8)

The length of segment [tex]\overline{AB}[/tex] = √((0.6 - 0.4)² + (1.6 - 0.4)²) = 0.2·√(37)

The length of segment [tex]\mathbf{\overline{CB}}[/tex] = √((0.8 - 0.6)² + (2.8 - 1.6)²) = 0.2·√(37)

The ratio of the lengths of the segment formed by transversal 1 is therefore;

[tex]\sqrt{x} \displaystyle Ratio \ of \ the \ length \ of \ the \ segments = \mathbf{\frac{\overline{CB}}{\overline{AB}}} =\frac{2 \cdot \sqrt{37} }{2 \cdot \sqrt{37} } = 1[/tex]

The points at which transversal 2 intersect the lines x, y, and z, are;

D(1.1, 3.1), E(1.3, 2.3), and F(1.5, 1.5)

The length of segment [tex]\overline{DE}[/tex] = √((1.3 - 1.1)² + (2.3 - 3.1)²) = 0.2·√(17)

The length of segment [tex]\overline{EF}[/tex] = √((1.5 - 1.3)² + (1.5 - 2.3)²) = 0.2·√(17)

[tex]\sqrt{x} \displaystyle Ratio \ of \ the \ length \ of \ the \ segments = \mathbf{\frac{\overline{EF}}{\overline{DE}}} =\frac{0.2 \cdot \sqrt{17} }{0.2 \cdot \sqrt{17} } = 1[/tex]

Therefore;

[tex]\displaystyle \frac{\overline{CB}}{\overline{AB}} = \frac{\overline{EF}}{\overline{DE}} = 1[/tex]

Which gives;

The proportion with which the parallel lines divide the transversals are equal.The ratio of the lengths for each transversal are equal.

The the comparison can also be made with the triangle proportionality theorem.

Learn more about triangle proportionality theorem here:

https://brainly.com/question/8160153


Related Questions

The diameter of a circle has endpoints at (0,11) and (-6,-1). Write the equation of the circle in standard form.

Answers

Answer:

(x - 3)^2 + (y - 6)^2 = 17

Step-by-step explanation:

The standard form of a circle's equation is (x-h)² + (y-k)² = r² where (h,k) is the center and r is the radius.

(x - 3)^2 + (y - 6)^2 = 17

Find the surface area of a cylinder with a height of 4 yd and a base radius of 3 yd.​

Answers

Answer:

131.95yd squared

Step-by-step explanation:

A=2πrh+ 2 r(2)=2*π*3*4+2*π*3(2)~131.94689yd(2)

In a two-digit number, the units digit is 5 more than the tens digit. The number is 6 less than 4 times the sum of the digits. Find the number.

Answers

Answer:

Tens digit, x = 3

Unit digit, y = 8

Number = 38

Step-by-step explanation:

Let the 2 digit number = xy

y = x + 5 - - - (1)

10x + y = 4(x + y) - 6

10x + x + 5 = 4(x + x + 5) - 6

11x + 5 = 4(2x + 5) - 6

11x + 5 = 8x + 20 - 6

11x + 5 = 8x + 14

11x - 8x = 14 - 5

3x = 9

x = 9/3

x = 3

From (1)

y = x + 5

y = 3 + 5

y = 8

a cookie factory uses 1/6 pf a barrel pf oatmeal in each batch of cookies, the factory used 1 1/3 barrels of oatmeal yesterday. how many batches of cookies did the factory make?

Answers

Answer:

5 batches

Step-by-step explanation:

1/6 oatmeal  can make 1 batch, so 5/6 makes 5 batches

plssssss helpppp !!
tysmmmm

Answers

I think that the answer would be two triangles.

please help!! i will give brainliest.

Answers

Answer:

3/10 inches apart

Step-by-step explanation:

total miles based on 2" equals 33 miles can be found by solving this proportion:

2/33 = 6/x

2x = 198

x = 99

99 miles divided by 11 rest stops means each stop is 9 miles apart

now use new ratio of 1" equals 30 miles

1/30 = x/9

30x = 9

x = 9/30 or 3/10 inches

A hockey tournament consists of 16 teams. In the first round, every team is randomly assigned to one of 8 games (2 teams per game). Suppose exactly 3 of the teams are from Alberta. What is the probability all 3 Alberta teams are randomly assigned to different games (call this event A)?

Answers

Given that a hockey tournament consists of 16 teams. In the first round, every team is randomly assigned to one of 8 games (2 teams per game). We are supposed to find the probability that all three Alberta teams are randomly assigned to different games. Let A be the event of assigning all three Alberta teams to different games.

Then the number of ways to select 3 teams from 16 teams is $\ dbinom {16}{3}$, the number of ways to assign 3 teams to different games is $8\times7\times6$, and the number of ways to assign the remaining 13 teams to games is $(13!) / (2^6\times6!)$.The probability of event A is given by;$$


P(A) = \frac{\text{number of ways to assign 3 teams from Alberta to different games}}{\text{number of ways to assign all teams to games}} = \frac{8\times7\times6 \times (13!) / (2^6\times6!)}{\dbinom{16}{3} \times (14!) / (2^7\times7!)}
$$Simplifying the above expression,$$
P(A) = \frac{8\times7\times6 \times 13! \times 2}{\dbinom{16}{3} \times 14!} = \frac{8\times7\times6 \times 2}{\dbinom {16}{3}} = \frac{336}{560} = \frac{3}{5}

Therefore, the probability that all three Alberta teams are randomly assigned to different games is $\frac{3}{5}$.

Know more about probability:

https://brainly.com/question/31828911

#SPJ11

Consider an election with 129 votes.

(a) If there are 4 candidates, what is the smallest number of votes that a plurality candidate could have? Explain your answer.

(b) If there are 8 candidates, what is the smallest number of votes that a plurality candidate could have? Explain your answer

Answers

(a) If there are 4 candidate,  the smallest number of votes that a plurality candidate could have is 33.

(b) If there are 8 candidate,  the smallest number of votes that a plurality candidate could have is 17.

What is the smallest number of votes obtained?

The smallest number of votes that a plurality candidate could have is calculated as follows;

(a) If there are 4 candidate, the number of votes for each candidate;

= 129 / 4

= 32.25

The least number of votes for the plurality candidate = 33

(b) If there are 8 candidate, the number of votes for each candidate;

= 129 / 8

= 16.125

The least number of votes for the plurality candidate = 17

Learn more about smallest number in division here: https://brainly.com/question/29898343

#SPJ4

which of the following rational functions has a horizontal asymptote at y = 3 and vertical asymptotes at x = 4 and x = –3?

Answers

To have a horizontal asymptote at y = 3 and vertical asymptotes at x = 4 and x = -3, the rational function should have the following form:

f(x) = (a polynomial in x) / ((x - 4)(x + 3))

The polynomial in the numerator can have any degree, but it must be of lower degree than the denominator.

Therefore, among the given rational functions, the one that satisfies these conditions would be the one in the form:

f(x) = (a polynomial) / ((x - 4)(x + 3))

Please provide the specific options you have, and I can help you determine which of those options matches this form.

Learn more about rational function here:

https://brainly.com/question/27914791

#SPJ11

function project: a day of fun

Answers

Answer:

Yay fun day :DDDDDD

Step-by-step explanation:

If you flip two coins, what is the probability that both will be heads?

Answers

Answer:

1/2 x 1/2 = 1/4

Step-by-step explanation:

P(H,H) = 1/2 x 1/2 = 1/4

P(T,T) = 1/2 x 1/2 = 1/4

P(H,T) = 1/2 x 1/2 = 1/4

P(T,H) = 1/2 x 1/2 = 1/4

Mark can make 9 pancakes in 15 minutes, and Charlotte can make 42 pancakes in 45 minutes. Working together, how many minutes would it take to make 138 pancakes?​

Answers

Answer:

60 mins

Step-by-step explanation:

15+45=60

The time needed to make 138 pancakes if both Mark and Charlotte work together is 227.142 minutes.

What is a Fraction?

A fraction is a way to describe a part of a whole. such as the fraction 1/4 can be described as 0.25.

As it is given that Mark can make 9 pancakes in 15 minutes, therefore, the number of pancakes that Mark can make in one minute,

[tex]\text{Number of Pancake in one minute} = \dfrac{9}{15}[/tex]

Now, for Charlotte, it is given that he makes 42 pancakes in 45 minutes, therefore, the number of pancakes that Charlotte can make in one minute,

[tex]\text{Number of Pancake in one minute} = \dfrac{42}{45} = \dfrac{12}{15}[/tex]

Further, the total pancakes that can be made in one minute,

[tex]\text{Total Number of Pancake in one minute} = \dfrac{9}{15} +\dfrac{12}{15} = \dfrac{21}{15}[/tex]

As they both need to make 138 pancakes together, therefore, the time they need is,

[tex]\rm Time\ Needed = \dfrac{\text{Total number of pancakes}}{\text{Total number of pancakes in one minute}}[/tex]

[tex]\rm Time\ Needed = \dfrac{138}{\frac{21}{15}} = \dfrac{138\times 15}{21} = 227.142[/tex]

Hence, the time needed to make 138 pancakes if both Mark and Charlotte work together is 227.142 minutes.

Learn more about Fraction:

https://brainly.com/question/1301963

Change from rectangular to spherical coordinates. (Let rho ≥ 0, 0 ≤ θ ≤ 2π, and 0 ≤ φ ≤ π.) (a) (5,5√3, 10√3 ) (rho,θ,φ) = (___) (b) (0,−3,−3) (rho,θ,φ) = (___)

Answers

The spherical coordinates for the point (0, -3, -3) are (3√2, -π/2, π/4).

(a) To change from rectangular coordinates to spherical coordinates, we use the following formulas:

rho = √(x² + y² + z²)

theta = atan2(y, x)

phi = acos(z / rho)

Given the rectangular coordinates (5, 5√3, 10√3), we can substitute the values into the formulas to find the corresponding spherical coordinates:

rho = √((5)² + (5√3)² + (10√3)²)

= √(25 + 75 + 300)

= √(400)

= 20

theta = atan2(5√3, 5)

= atan(√3)

≈ 1.0472 radians

phi = acos((10√3) / 20)

= acos(√3 / 2)

= π/6 radians

Therefore, the spherical coordinates for the point (5, 5√3, 10√3) are (20, 1.0472, π/6).

(b) Given the rectangular coordinates (0, -3, -3), we can apply the formulas for spherical coordinates:

rho = √((0)² + (-3)² + (-3)²)

= √(0 + 9 + 9)

= √(18)

= 3√2

theta = atan2(-3, 0)

= -π/2 radians

phi = acos((-3) / (3√2))

= acos(-1/√2)

= π/4 radians

Hence, the spherical coordinates for the point (0, -3, -3) are (3√2, -π/2, π/4).

To know more about coordinates follow the link:

https://brainly.com/question/29189189

#SPJ4

How many yards are equivalent to 38 feet? Show your work.

Answers

Answer:

12.6

Step-by-step explanation:

divide the length value by 3

[12.6)now can u help me with my history work

I AM GIVING BRAINLIEST TO WHOEVER ANSWERS, IF IT SAYS IT'S ALREADY ANSWERED, IT'S A LINK. PLEASE HELP ME :D

Answers

I’m tired of these people and their fake a** link

Please help me solve these two questions

Answers

I hope the answer is helpful

i’m sorry this isn’t an answer i just rly need points so i can ask a test question

Last translation I need help with I promise-

Answers

The types of transformation in this problem is given as follows:

Vertical and horizontal translation.

What are the translation rules?

The four translation rules are defined as follows:

Left a units: x -> x - a. -> horizontal translation.Right a units: x -> x + a. -> horizontal translation.Up a units: y -> y + a. -> vertical translation.Down a units: y -> y - a. -> vertical translation.

The translations for this problem are given as follows:

3 units left -> horizontal translation.3 units up -> vertical translation.

More can be learned about translation at brainly.com/question/29209050

#SPJ1

(x_6)(x_5)+(x_5)(x_6)​

Answers

Answer:

(X+6)(x-5) + (X-5)(X+6)

Answer:

[tex]2x ^{2} - 22x + 60[/tex]

I need help on this math problem fast with work shown and answer thx

Answers

Answer:

angle 1 = 124

angle 2 = 56

angle 3 = 124

angle 4 = 56

Step-by-step explanation:

This problem is a bit like a puzzle. To make notation easier I'm going to do this:

angle 1 = a

angle 2 = b

angle 3 = c

angle 4 = d

Now, let's start with what we know from the image.

All angles added together form a circle or 360 degrees

a + b + c + d = 360

In the same regard a + d = 180, and b + c = 180

Also,

a = c

and

b = d

It also tells us angle 4 is 25 degrees greater than one fourth of angle 1. Which is written as.

d = 1/4(a) + 25

If we look at all the equations we have, we can see that two of the equations have two of the same variables:

a + d = 180

and

d = 1/4(a) + 25

Using substitution we can take the second equation substitute it for d in the first equation giving us:

a + (1/4(a) + 25) = 180

Now we just solve for a

[tex]\frac{4}{4} a+ \frac{1}{4} a + 25 = 180\\\\\frac{5}{4}a + 25 = 180 \\\\(\frac{5}{4}a + 25) - 25 = (180) -25\\\\\frac{5}{4} a = 155\\\\\frac{5}{4} a * \frac{4}{5} = 155 * \frac{4}{5}\\\\a = 124[/tex]

Therefore a, or angle 1, is 124

Since a = c, then c, or angle 3, is also 124

Since a + d = 180 and a = 124 then

d = 180 -124

d = 56

So, d, or angle 4, is 56

And because b = d then b, or angle 2, is also 56

a = 124

b = 56

c = 124

d = 56

For extra measure, we can check our work by using the first equation

a + b + c + d = 360

124 + 56 + 124 + 56 = 360

Write in standard form
531800000

Answers

Answer:

5.318 * 10 to power of 8

Step-by-step explanation:

Answer:

5.318 × [tex]10^{8}[/tex]

Step-by-step explanation:

what is the positive solution to the equation 4x^{2}+12x=135

Answers

Answer:

9/2 = 4 1/2

Step-by-step explanation:

What is the perimeter of abcd ?

Answers

Answer:

38

Step-by-step explanation:

(10*2)+(9*2)

Let M = {x +1, x2 – 2,3x}. Which of the following statements is true about M? M spans P3 O the above is true M spans P2 O the above is true O None of the mentioned

Answers

The correct statement is : M spans P2.

The set M = {[tex]x+1, x^2-2, 3x[/tex]} consists of three polynomials in the variable x.

To determine whether M spans P3 or P2, we need to consider the highest degree of the polynomials in M.

The highest degree of the polynomials in M is 2 (from [tex]x^2-2[/tex]), which means that M can span at most the space of polynomials of degree 2 or less, i.e., P2.

To check whether M spans P2 or not, we need to see if any polynomial of degree 2 or less can be expressed as a linear combination of the polynomials in M.

We can write any polynomial of degree 2 or less as [tex]ax^2 + bx + c[/tex], where a, b, and c are constants.

To express this polynomial as a linear combination of the polynomials in M, we need to solve the system of equations:

[tex]a(x^2-2) + b(x+1) + c(3x) = ax^2 + bx + c[/tex]

This can be written as:

[tex]ax^2 + (-2a+b+3c)x + (b+c) = ax^2 + bx + c[/tex]

Equating the coefficients of [tex]x^2, x,[/tex] and the constant term, we get:

[tex]a = a,\\-2a+b+3c = b,\\b+c = c.[/tex]

The first equation is always true, and the other two equations simplify to:

[tex]-2a+3c = 0,\\b = 0.[/tex]

Solving for a, b, and c, we get:

[tex]a = 3c/2,\\b = 0,\\c = c.[/tex]

Therefore, any polynomial of degree 2 or less can be expressed as a linear combination of the polynomials in M. This means that M spans P2.

However, M cannot span P3, because P3 includes polynomials of degree 3, which cannot be expressed as a linear combination of the polynomials in M (since the highest degree polynomial in M is [tex]x^2[/tex]).

Therefore, the correct statement is: M spans P2.

Learn more about Polynomial span : https://brainly.com/question/31857690

#SPJ11

Read the story.
Nolan reads his little sister one of her two favorite books each night before bed. This month, she has chosen the mermaid book 3 times for every 2 times she has chosen the princess book.
Pick the diagram that models the ratio in the story.
If Nolan has read his sister a book before bed 20 times this month, how many times has he read the mermaid book?

Answers

Answer:The diagram that models the ratio in the story is:

Mermaid book: Princess book = 3:2

To find out how many times Nolan has read the mermaid book, we can set up the following proportion:

3/2 = x/20

Cross-multiplying, we get:

2x = 3 * 20

2x = 60

Dividing both sides by 2, we find:

x = 60/2

x = 30

Therefore, Nolan has read the mermaid book 30 times this month.

Complete the table of values y = x2 + 4x - 6

Answers

Answer:

x=-2

Step-by-step explanation:

Probability 0.35 0.3 0.05 0.1 0.05 0.15 8 9 10 11 Find the expected value of the above random variable.

Answers

The expected value of the given random variable is 8.3. This means that, on average, if we repeatedly sample from this random variable, we can expect the resulting values to be around 8.3.

To find the expected value of a random variable, you multiply each possible value by its corresponding probability and sum them up. In this case, we have a combination of probabilities and numerical values. Let's calculate the expected value:

Multiply each numerical value by its corresponding probability:

(0.35 * 8) + (0.3 * 9) + (0.05 * 10) + (0.1 * 11) + (0.05 * 11) + (0.15 * 11)

Perform the calculations:

2.8 + 2.7 + 0.5 + 1.1 + 0.55 + 1.65

Sum up the results:

8.3

Therefore, the expected value of the given random variable is 8.3. This means that, on average, if we repeatedly sample from this random variable, we can expect the resulting values to be around 8.3. The expected value provides a measure of central tendency for the random variable.

Learn more about Central Tendency:

https://brainly.com/question/28180169

#SPJ4

Find the missing side length of
the triangle.

Answers

Answer:

50 units

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right  

Equality Properties

Trigonometry

[Right Triangles Only] Pythagorean Theorem: a² + b² = c²

a is a leg b is another leg c is the hypotenuse

Step-by-step explanation:

Step 1: Define

a = 48

b = 14

c = ?

Step 2: Solve for c

Substitute in variables [Pythagorean Theorem]:                                            48² + 14² = c²Evaluate exponents:                                                                                         2304 + 196 = c²Add:                                                                                                                   2500 = c²[Equality Property] Square root both sides:                                                    50 = cRewrite:                                                                                                             c = 50

Find all the missing elements
Round to the nearest tenth.

Answers

Answer:

B = 48.7°

C = 61.3°

b = 12

Step-by-step explanation:

Given:

A = 70°

a = 15

c = 14

Required:

B, C, and b

Solution:

✔️Using the law of sines, let's find C:

Sin C/c = Sin A/a

Plug in the values

Sin C/14 = Sin 70/15

Cross multiply

Sin C × 15 = Sin 70 × 14

Divide both sides by 15

Sin C = (Sin 70 × 14)/15

Sin C = 0.8770

C = Sin^{-1}(0.8770)

C = 61.282566° = 61.3° (nearest tenth)

✔️Find B:

B = 180 - (70 + 61.3) (sum of triangle)

B = 48.7°

✔️Find b using the law of sines:

b/sinB = a/sinA

Plug in the values

b/sin 48.7 = 15/sin 70

Cross multiply

b*sin 70 = 15*sin 48.7

Divide both sides by sin 48.7

b = (15*sin 48.7)/sin 70

b = 11.9921789

b = 12.0 (nearest tenth)

(Fermat's Theorem, 5pt) Calculate 2^2873686243768478237864767208 mod 101 using Fermat's little theorem (that is, without computer, and without repeated squaring). Explain how you did it. Hint: 101 is prime.

Answers

To calculate[tex]2^2873686243768478237864767208[/tex] mod 101 using Fermat's little theorem, we can simplify the exponent by taking it modulo 100, since 100 is the Euler's totient function value of 101. Therefore,[tex]2^2873686243768478237864767208[/tex] mod 101 is equal to 57.

Fermat's little theorem states that if p is a prime number and a is any integer not divisible by p, then a^(p-1) ≡ 1 (mod p). In this case, p = 101, and we need to find[tex]2^2873686243768478237864767208[/tex]mod 101.

First, we simplify the exponent by taking it modulo 100, since 100 is the Euler's totient function value of 101. The exponent 2873686243768478237864767208 is congruent to 8 modulo 100. So, we need to calculate 2^8 mod 101. Applying Fermat's little theorem, we know that 2^(101-1) ≡ 1 (mod 101), since 101 is prime. Therefore, 2^100 ≡ 1 (mod 101).

We can express [tex]2^8[/tex] in terms of 2^100 as [tex](2^100)^0.08[/tex]. Simplifying this, we get [tex](2^100)^0.08 ≡ 1^0.08[/tex]≡ 1 (mod 101).

Thus, we conclude that[tex]2^8[/tex] ≡ 1 (mod 101), and therefore 2^2873686243768478237864767208 ≡ [tex]2^8[/tex] (mod 101).

Finally, evaluating [tex]2^8[/tex] mod 101, we find that [tex]2^8[/tex] ≡ 57 (mod 101).

Therefore,[tex]2^2873686243768478237864767208[/tex] mod 101 is equal to 57.

Learn more about congruent here:

https://brainly.com/question/30596171

#SPJ11

Joe's lunch at a restaurant cost $18.00 without tax he leaves the server a tip of 14% of the cost of lunch without tax what is the total cost of lunch including tip without tax​

Answers

Ok. So 14% of 18.00 can be figured out without a calculator. 18.00 / 10 = 1.80 = 10%.

(18.00 / 100) x 4 = 0.72

1.80 + 0.72 = $2.52 is the tip.

$18 + $2.52 = $20.52

⭐ Answered by Foxzy0⭐

⭐ Brainliest would be appreciated, I'm trying to reach genius! ⭐

⭐ If you have questions, leave a comment, I'm happy to help! ⭐

Other Questions
Match the value chain activity in the left column with the scenario in the right column.Value Chain ActivityScenario1.Service activities2.Inbound logistics3.Marketing and sales activities4.Firm Infrastructure5.Human resource management6.Technology7.Procurement8.Outbound logistics9.OperationsChoose from:Assembly line, Buying (sourcing) raw materials, CEO and CFO, Delivery to the firm's customer, New-product development, Receiving dock and raw materials, Surveys for prospect customers, Warranty work, Worker recruitment Describe how the Spanish-American War was started? In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis.