suppose a moving object has a kinetic energy of 1/2mv^2=100j . What will be the object’s kinetic energy if...
(a) its speed is doubled?
(b) its mass is doubled?

Answers

Answer 1

(a) If the speed of the moving object is doubled, its kinetic energy will become four times greater.



(b) If the mass of the moving object is doubled, its kinetic energy will also become twice as much.

a) This is because kinetic energy is directly proportional to the square of the velocity, as shown in the equation KE = 1/2mv². Therefore, doubling the speed will result in a kinetic energy of 400 J.

b) This is because kinetic energy is directly proportional to the mass, as shown in the equation KE = 1/2mv². Therefore, doubling the mass will result in a kinetic energy of 200 J.

Kinetic energy is the energy that an object possesses due to its motion. It is calculated using the formula KE = 1/2mv², where m is the mass of the object and v is its velocity. This formula shows that kinetic energy is directly proportional to the mass and the square of the velocity of the object.

This means that any change in mass or velocity will have a direct effect on the object's kinetic energy. When the speed is doubled, the kinetic energy becomes four times greater because velocity is squared in the formula.

When the mass is doubled, the kinetic energy becomes twice as much because mass is directly proportional to kinetic energy.

To know more about kinetic energy click on below link:

https://brainly.com/question/999862#

#SPJ11


Related Questions

What is the acceleration on a 2kg object that had 400J of work done on it over 50m?

Answers

Answer: the acceleration of the object is 4 m/s^2.

Explanation: To determine the acceleration of the object, we can use the work-energy principle, which states that the work done on an object is equal to its change in kinetic energy. The equation for the work-energy principle is:

W = ΔKE = (1/2)mv^2 - (1/2)mu^2

where W is the work done, ΔKE is the change in kinetic energy, m is the mass of the object, v is the final velocity of the object, and u is the initial velocity of the object (which we assume to be zero).

We can rearrange this equation to solve for the final velocity v:

v^2 = (2W/m) + u^2

Since the initial velocity is zero, this simplifies to:

v^2 = 2W/m

Now, we can use the equation for average acceleration:

a = (v - u) / t

where t is the time taken to travel the distance of 50m. Assuming that the object starts from rest, u = 0, and the equation simplifies to:

a = v / t

Substituting the expression for v, we get:

a = sqrt(2W/m) / t

Plugging in the given values of W = 400 J, m = 2 kg, and t = 50 m / v (since t = d/v), we get:

a = sqrt(2*400 J / 2 kg) / (50 m / v)

a = sqrt(400 m^2/s^2) / (50 m / v)

a = 4 m/s^2

Therefore, the acceleration of the object is 4 m/s^2.

Share Prompt

in the median plane of an electric dipole is the electric field parallel or antiparallel to the electric dipole moment.explain.........

Answers

In the median plane of an electric dipole, the electric field is neither parallel nor antiparallel to the electric dipole moment. Instead, it is perpendicular to the electric dipole moment.

What is Dipole Moment?

Dipole moment is a concept in physics that describes the magnitude and direction of the separation of electric charge in a system with a dipole, such as a molecule or an object with an uneven distribution of charge. It is a measure of the polarity or asymmetry of a charge distribution.

The electric field lines in the median plane of an electric dipole form circular loops around the dipole axis. At points on the perpendicular bisector of the dipole (i.e., in the median plane), the electric field lines are symmetrically distributed around the dipole axis, and the electric field is directed perpendicular to the dipole moment vector.

Learn more about Dipole Moment from the given link

https://brainly.com/question/11626115

#SPJ1

Consider a particle with rest mass m _0, momentum p. and kinetic- energy T. Show that p^2c^2 = T(2m _0 c^2 + T).

Answers

p^2c^2 = T(2m _0 c^2 + T) is true when considered a particle with rest mass m _0, momentum p. and kinetic- energy T.

To begin, we know that the total energy of a particle with rest mass m_0 and momentum p is given by E^2 = (mc^2)^2 + (pc)^2, where m is the relativistic mass of the particle and c is the speed of light.

We can rearrange this equation to solve for m: m^2c^4 = E^2 - (pc)^2

Since we are dealing with a particle with kinetic energy T, we know that the total energy of the particle is given by E = T + m_0c^2.

Substituting this into our equation for m, we get:

(m_0 + m)^2c^4 = (T + m_0c^2)^2 - (pc)^2

Expanding the right side of the equation, we get:

m_0^2c^4 + 2m_0Tc^2 + T^2 = T^2 + 2m_0Tc^2 + m_0^2c^4 + 2m_0Tc^2 - (pc)^2

Simplifying and rearranging, we get:

(pc)^2 = T(2m_0c^2 + T)

Finally, we can substitute p = mv (where v is the velocity of the particle) and E = mc^2 + T into the expression for (pc)^2 to get:

p^2c^2 = (mc)^2c^2 = (E^2 - T^2)c^2 = [(mc^2 + T)^2 - T^2]c^2 = [2m_0c^2 + T]T

Therefore, we have shown that p^2c^2 = T(2m_0c^2 + T), as required.

For more such questions on Kinetic energy.

https://brainly.com/question/14984843#

#SPJ11

A hollow copper wire with an inner diameter of 1.1 mm and an outer diameter of 1.8 mm carries a current of 15 A. What is the current density in the wire? Please show work. I got 3.9 *10^7 A/m^2, but I was wrong. Thanks in advance.

Answers

The current density is:9.41*10⁶ A/m²


Current density in wire is :

J= I/A

J: current density

I: Current

A: cross sectional area of wire

cross sectional area of wire= Π [{(1.8*10⁻³)/2}² - {(1.1*10⁻³)/2}]²

= 1.59*10⁻⁶ m²

hence, J= 15/1.59*10⁻⁶  = 9.41*10⁶ A/m²\

To know more about Current density here:

https://brainly.com/question/15266434#

#SPJ11

A 14.0-foot-long, nearsighted python is stretched out perpendicular to a plane mirror, admiring its reflected image. If the greatest distance to which the snake can see clearly is 22.0 ft, how close must its head be to the mirror for it to see a clear image of its tail?
______ ft.

Answers

The python's head must be [tex]4.0 feet[/tex]  away from the mirror to see a clear image of its tail. The answer is [tex]4.0 feet[/tex].

The python's head must be to the mirror to see a clear image of its tail, The concept of the virtual image formed by the mirror.

Given:

Length of the python [tex](L)= 14.0 feet[/tex]

Greatest distance to which the snake can see clearly (distance of clear vision) = [tex]22.0 feet[/tex]

Let's assume that the python's head is at a distance x feet from the mirror.

According to the concept of the virtual image formed by the mirror, the image distance is equal to the object distance:

[tex]d_{(image)} = d_{(object)}[/tex]

The calculation is as follows:

[tex]x = (22.0- 14.0) - x\\2x = 22.0 - 14.0\\x = 8.0 / 2\\x = 4.0\ feet[/tex]

So, the python's head must be [tex]4.0 feet[/tex] away from the mirror to see a clear image of its tail.

To know more about the image and object:

https://brainly.com/question/12413449

#SPJ12

Given a starting guess of xo = 0.4, what is the next step in approximating a minimum of f(1) = cos(z) using Newton's method for optimization?

Answers

The next step in approximating a minimum of f(z) using Newton's method for optimization is to calculate the derivative of the function at the starting point, which is xo = 0.4.

This derivative is given by f'(xo) = -sin(xo). The next step is to use this derivative to calculate the next guess, which is given by x1 = xo - [f(xo)/f'(xo)]. In this case, x1 = 0.4 - [cos(0.4)/-sin(0.4)]. This new guess will be used to calculate the next derivative, and this process will be repeated until the value of the derivative is close to zero, which indicates a minimum of the function.

Newton's method for optimization is a powerful tool that can be used to quickly and accurately approximate a minimum of a function given a starting point.

know more about Newton's method here

https://brainly.com/question/14865059#

#SPJ11

What charge is stored in a 180 µF capacitor when 120 V is applied to it?

Answers

The charge stored in the 180 µF capacitor when 120 V is applied to it is 0.0216 coulombs

The charge stored in a 180 µF capacitor when 120 V is applied to it can be calculated using the formula Q = CV, where Q is the charge stored, C is the capacitance in farads, and V is the voltage applied. Plugging in the given values, we get [tex]Q = (180 * 10^(-6) F)[/tex] x (120 V) = 21.6 µC (microcoulombs). Therefore, 21.6 µC of charge is stored in the capacitor.
To find the charge stored in a 180 µF capacitor when 120 V is applied to it, we can use the formula:

Q = C × V

Where:
Q = charge stored (in coulombs),
C = capacitance (in farads),
V = voltage applied (in volts).

Step 1: Convert the capacitance to farads:
[tex]180 µF = 180 * 10^(-6) F = 0.00018 F[/tex]

Step 2: Plug the capacitance and voltage values into the formula:
Q = 0.00018 F * 120 V

Step 3: Calculate the charge stored:
Q = 0.0216 C

Learn more about capacitor here:

https://brainly.com/question/29100869

#SPJ11

a 10cm×10cm square is bent at a 90∘ angle. a uniform 4.90×10−2 t magnetic field points downward at a 45∘ angle.
What is the magnetic flux through the loop?

Answers

Magnetic flux through the loop is approximately 3.46 x [tex]10^{-5}[/tex] Weber (Wb).

What is Magnetic Flux?

Magnetic flux is a measure of the amount of magnetic field passing through a given area. It is defined as the total magnetic field passing through a surface area perpendicular to the magnetic field lines.

The magnetic flux through the loop can be calculated using the formula for magnetic flux:

Φ = B * A * cos(θ)

where:

Φ = magnetic flux (in Weber, Wb)

B = magnetic field strength (in Tesla, T)

A = area of the loop (in square meters, [tex]m^{2}[/tex])

θ = angle between the magnetic field and the normal to the loop (in radians)

Given:

B = 4.90 x [tex]10^{-2}[/tex]) T (magnetic field strength)

A = 10 cm x 10 cm = 0.1 m x 0.1 m = 0.01 [tex]m^{2}[/tex] (area of the loop)

θ = 45 degrees = 45 * (π/180) radians (angle between the magnetic field and the normal to the loop)

Plugging in these values into the formula:

Φ = (4.90 x [tex]10^{-2}[/tex]T) * (0.01 [tex]m^{2}[/tex]) * cos(45 * (π/180))

Using a calculator to calculate cos(45 * (π/180)), we get:

Φ = (4.90 x [tex]10^{-2}[/tex]T) * (0.01 [tex]m^{2}[/tex]) * 0.7071

Finally, multiplying the numbers, we get:

Φ ≈ 3.46 x [tex]10^{-5}[/tex]Wb

Learn more about Magnetic Flux from the given link

https://brainly.com/question/29221352

#SPJ1

A vertical column load, P = 600 kN, is applied to a rigid concrete foundation with dimensions B = 1 m and L = 2 m. The foundation rests at a depth Df = 0.75 m on a uniform dense sand with the following properties: average modulus of elasticity, Es = 20,600 kN/m2, and Poisson’s ratio, μs = 0.3. Estimate the elastic settlement due to the net applied pressure, Δσ, on the foundation. Given: H = 5 m.

Answers

The estimated elastic settlement due to the net applied pressure of 600 kN on the foundation is 1.86 mm.

To estimate the elastic settlement due to the net applied pressure, Δσ, on the foundation, we can use the following equation:

Δs = (Δσ / Es) * ((1 - μs) / (1 + μs)) * (B / (2 * (Df + H)))

Where Δs is the elastic settlement, Δσ is the net applied pressure, Es is the average modulus of elasticity of the sand, μs is the Poisson's ratio of the sand, B is the width of the foundation, Df is the depth of the foundation, and H is the height of the sand layer.

Substituting the given values, we get:

Δs = (600 / 20600) * ((1 - 0.3) / (1 + 0.3)) * (1 / (2 * (0.75 + 5))) = 0.00186 m or 1.86 mm

Therefore, the estimated elastic settlement due to the net applied pressure of 600 kN on the foundation is 1.86 mm.

To know more about elastic settlement refer here:

https://brainly.com/question/30076088

#SPJ11

The preexponential and activation energy for the diffusion of chromium in nickel are 1.1x10

4
m
2
/s and 272000 J/mol, respectively. At what temperature will the diffusion coeffcient have a value of 1.2x10

14
m
2
/s?

Answers

The temperature at which the diffusion coefficient has a value of 1.2x10⁻¹⁴ m²/s is 803 K.

What is temperature?

Temperature is a physical property of matter that can be measured with thermometers. It is a measure of the average kinetic energy of the particles that make up a substance. Temperature is expressed in degrees Celsius, Fahrenheit, or Kelvin.

The diffusion coefficient can be calculated using the Arrhenius equation:
D = [tex]A\times e ^ {(-Ea/RT)[/tex]
where D is the diffusion coefficient, A is the preexponential factor, Ea is the activation energy, R is the gas constant, and T is the temperature.
In this case, A = 1.1x10⁻⁴ m²/s and Ea = 272000 J/mol. We can rearrange the equation to solve for T:
T = (−Ea/R)⋅ln(D/A)
Plugging in the given values, we get:
T = (−272000 J/mol/8.314 J/mol/K)⋅ln(1.2x10⁻¹⁴ m²/s/1.1x10⁻⁴ m²/s)
T ≈ 803 K
Therefore, the temperature at which the diffusion coefficient has a value of 1.2x10⁻¹⁴ m²/s is 803 K.

To learn more about temperature
https://brainly.com/question/27944554
#SPJ1

The temperature at which the diffusion coefficient has a value of 1.2x10⁻¹⁴ m²/s is 803 K.

What is temperature?

Temperature is a physical property of matter that can be measured with thermometers. It is a measure of the average kinetic energy of the particles that make up a substance. Temperature is expressed in degrees Celsius, Fahrenheit, or Kelvin.

The diffusion coefficient can be calculated using the Arrhenius equation:
D = [tex]A\times e ^ {(-Ea/RT)[/tex]
where D is the diffusion coefficient, A is the preexponential factor, Ea is the activation energy, R is the gas constant, and T is the temperature.
In this case, A = 1.1x10⁻⁴ m²/s and Ea = 272000 J/mol. We can rearrange the equation to solve for T:
T = (−Ea/R)⋅ln(D/A)
Plugging in the given values, we get:
T = (−272000 J/mol/8.314 J/mol/K)⋅ln(1.2x10⁻¹⁴ m²/s/1.1x10⁻⁴ m²/s)
T ≈ 803 K
Therefore, the temperature at which the diffusion coefficient has a value of 1.2x10⁻¹⁴ m²/s is 803 K.

To learn more about temperature
https://brainly.com/question/27944554
#SPJ1

A 2 GHz radar antenna of effective area 6.0 m2 transmits 100 kW. If a target with a 12 m2 radar cross section is 100 km away, (a) what is the round-trip travel time for the return radar pulse (b) what is the received power (c) what is the maximum detectable range if the radar system has a minimum detectable power of 2.0 pW. (1 pw = 10-12 W)

Answers

A. The round-trip travel time of the radar pulse is 6.7 x 10⁻⁴ s.

B. The received power is 1.6 x 10⁻⁵ W.

C. The maximum detectable range of the radar system is 16.2 km.

The round-trip travel time for the return radar pulse can be calculated using the formula for the speed of light, c = 3 x 10⁸ m/s, and the distance of 100 km, as t = 2 x 100 km/3 x 10⁸ m/s = 6.7 x 10⁻⁴ s.

The received power can be calculated by using the radar equation, Pr = PtxGtxAe/4πr², where Pr is the received power, Ptx is the transmitted power of 100 kW, Gtx is the antenna gain, Ae is the effective area of 6.0 m2, r is the distance of 100 km, and 4π is a constant. Substituting these values gives Pr = 1.6 x 10⁻⁵ W.

The maximum detectable range can be calculated using the minimum detectable power, Pmin, of 2.0 pW and the radar equation, as rmax = sqrt(PtxGtxAe/4πPmin). Substituting these values in the equation gives rmax = 16.2 km.

Know more about radar pulse here

https://brainly.com/question/17166731#

#SPJ11

a soccer ball with mass 0.440 kg is initially moving with speed 2.30 m/s. a soccer player kicks the ball, exerting a constant force of magnitude 43.0 n in the same direction as the ball's motion.Over what distance must her foot be in contact with the ball to increase the ball's speed to 6.00m/s ?

Answers

The distance required for the foot to be in contact with the ball in order to increase its speed from 2.30 m/s to 6.00 m/s is 2.42 meters.

How to find distance required for the foot to be in contact with the ball?

We can use the equation for work done by a constant force, which is given by:

W = Fd cos(θ )

where W is the work done, F is the force applied, d is the distance over which the force is applied, and θ is the angle between the force and the displacement.

In this case, the force is applied in the same direction as the displacement, so θ = 0. Therefore, we can simplify the equation to:

W = Fd

We can also use the work-energy theorem, which states that the work done on an object is equal to the change in its kinetic energy:

W = (1/2)mv2 - (1/2)mv1

where m is the mass of the object, v1 is its initial velocity, and v2 is its final velocity.

Combining these equations, we have:

Fd = (1/2)mv2 - (1/2)mv1

Solving for d, we get:

d = (1/2F)mv2 - (1/2F)mv1

Plugging in the given values, we get:

d = (1/2 x 43.0 N) x 0.440 kg x (6.00 m/s - 2.30 m/s)

d = 2.42 m

Therefore, the foot must be in contact with the ball over a distance of 2.42 meters to increase the ball's speed to 6.00 m/s.

Learn more about Work done

brainly.com/question/13662169

#SPJ11

Inside a nuclear power plant, energy is liberated as nuclear reactions proceed inside the core. As this happens, the mass of the nuclei
Decreases.
Stays the same.
Increases.

Answers

Inside a nuclear power plant, energy is liberated as nuclear reactions proceed inside the core. As this happens, the mass of the nuclei decreases.

This decrease in mass occurs because some of the mass is converted into energy according to Einstein's famous equation, E=mc², where E is the energy, m is the mass, and c is the speed of light. Nuclear reactions are processes in which one or more nuclides are produced from the collisions between two atomic nuclei or one atomic nucleus and a subatomic particle. The nuclides produced from nuclear reactions are different from the reacting nuclei (commonly referred to as the parent nuclei). E = mc2 is the key to understanding why and how energy is released in nuclear reactions. Two concepts are central to both nuclear fission and fusion: First, the mass of a nucleus is less than the sum of the masses the nucleons would have if they were free. This is called the mass defect.

Learn more about nuclear reactions here: https://brainly.com/question/25387647

#SPJ11

a tin can has a total volume of 1290 cm3 and a mass of 115 g. how many grams of lead shot of density 11.4 g/cm3 could it carry without sinking in water?

Answers


The tin can could carry 1175 g of lead shot without sinking in water with lead shot of density 11.4 g/cm3  .

To determine how many grams of lead shot a tin can of total volume 1290 cm3 and mass 115 g can carry without sinking in water, we need to calculate the maximum weight the can can hold without exceeding the buoyancy force of water.

First, we need to calculate the density of the tin can. Density is mass divided by volume, so:

density of tin can = mass of tin can / total volume of tin can
density of tin can = 115 g / 1290 cm3
density of tin can = 0.089 g/cm3

Next, we need to calculate the maximum weight of lead shot that the tin can can hold without sinking in water. This is equal to the weight of the water displaced by the can and the lead shot. The density of water is 1 g/cm3.

weight of water displaced = volume of can and lead shot * density of water
weight of water displaced = total volume of tin can * density of water
weight of water displaced = 1290 cm3 * 1 g/cm3
weight of water displaced = 1290 g

To calculate the maximum weight of lead shot the can can hold without sinking in water, we need to subtract the weight of the tin can from the weight of the water displaced, and divide by the density of lead shot:

maximum weight of lead shot = (weight of water displaced - weight of tin can) / density of lead shot
maximum weight of lead shot = (1290 g - 115 g) / 11.4 g/cm3
maximum weight of lead shot = 1062.28 / g

Therefore, the tin can could carry a maximum of 1062.28 g of lead shot of density 11.4 g/cm3 without sinking in water.
To determine how many grams of lead shot the tin can could carry without sinking in water, we need to calculate the buoyant force and ensure that the combined weight of the tin can and lead shot does not exceed it.

First, we find the buoyant force by calculating the weight of the water displaced by the tin can. The volume of water displaced is equal to the total volume of the tin can (1290 cm³). The density of water is 1 g/cm³.

Buoyant force = Density of water × Volume displaced × g
(g is the acceleration due to gravity, but since we're dealing with densities and masses in grams, it will cancel out in our calculations)

Buoyant force = 1 g/cm³ × 1290 cm³ = 1290 g

Now, we need to ensure that the combined weight of the tin can and lead shot is less than or equal to the buoyant force:

Combined weight = Weight of tin can + Weight of lead shot

Since we know the weight of the tin can is 115 g, we can solve for the weight of the lead shot:

Weight of lead shot = Buoyant force - Weight of tin can
Weight of lead shot = 1290 g - 115 g = 1175 g

The tin can could carry 1175 g of lead shot without sinking in water.

To know more about lead shot of density click here:

brainly.com/question/28770396

#SPJ11

displays a 12.0 V battery and 3 uncharged capacitors of capacitances C1 = 4 mu F, C2 = 6 mu F, and C3 = 3 mu F. The switch is thrown to the left side until capacitor 1 is fully charged. Then the switch is thrown to the right. What is the final charge on (a) capacitor 1, (b) capacitor 2, and (c) capacitor 3?

Answers

(a) The final charge on capacitor 1 is 48 microcoulombs.

(b) The final charge on capacitor 2 is 36 microcoulombs.

(c) The final charge on capacitor 3 is 24 microcoulombs.

When the switch is thrown to the left side, capacitor 1 charges to 12 volts. Then, when the switch is thrown to the right, capacitors 1 and 2 are in parallel with each other and in series with capacitor 3. The total capacitance in the circuit is 2.4 microfarads. Using the equation [tex]Q = CV,[/tex]where Q is the charge, C is the capacitance, and V is the voltage, the final charge on capacitor 1 is [tex](4/2.4) x 12 = 48[/tex]  microcoulombs, on capacitor 2 is [tex](6/2.4) x 12 = 36[/tex]  microcoulombs, and on capacitor 3 is[tex](3/2.4) x 12 = 24[/tex] microcoulombs.

Learn more about final charge here:

https://brainly.com/question/30514270

#SPJ11

according to faraday’s law and lenz’s law, what should happen to the current in a coil of wire when the north pole of a bar magnet is moved toward it?

Answers

The current in the coil of wire should be induced, flowing in a direction that opposes the motion of the magnet.

According to Faraday's Law, when a magnetic field is changed, an electromotive force (EMF) is induced in a nearby conductor. Lenz's Law states that the direction of the induced current creates a magnetic field that opposes the change in magnetic flux that induced it. Therefore, as the north pole of the magnet approaches the coil, a magnetic flux is created and the induced current flows in a direction that produces a magnetic field in the opposite direction. This opposes the motion of the magnet, slowing it down. When the magnet is moved away, the opposite happens and the induced current flows in the opposite direction.

learn more about current here:

https://brainly.com/question/31309522

#SPJ11

11. let ∼ be an equivalence relation on a. prove that if a ∼b, then [a] = [b].

Answers

If a ∼ b, then [a] = [b] by the definition of equivalence relation.

An equivalence relation is a relation that satisfies three properties: reflexivity, symmetry, and transitivity. If a ∼ b, then by the reflexivity property, a is related to itself, which implies that a is in the equivalence class [a].

Similarly, by the symmetry property, if a is related to b, then b is related to a, which implies that b is also in the equivalence class [a]. Therefore, [a] contains both a and b.

Now, using the transitivity property, since a is related to b and b is related to a, it follows that a is related to a, which implies that a is in the equivalence class [b]. Therefore, [a] = [b].

For more questions like Symmetry click the link below:

https://brainly.com/question/1531736

#SPJ11

a 2.0 kg-ball moving at 3.0 m/s perpendicular to a wall rebounds from the wall at 2.5 m/s. the change in the momentum of the ball is

Answers

The change in momentum of the ball after it rebounds from the wall at 2.5 m/s is -1.0 kg.m/s.

The change in the momentum of the ball can be calculated using the formula:

change in momentum = final momentum - initial momentum

To find the initial momentum, we multiply the mass of the ball (2.0 kg) by its initial velocity (3.0 m/s):

initial momentum = 2.0 kg × 3.0 m/s = 6.0 kg*m/s

To find the final momentum, we multiply the mass of the ball (2.0 kg) by its final velocity (2.5 m/s):
final momentum = 2.0 kg × 2.5 m/s = 5.0 kg*m/s

Therefore, the change in momentum of the ball is:
change in momentum = final momentum - initial momentum
change in momentum = 5.0 kg*m/s - 6.0 kg*m/s
change in momentum = -1.0 kg*m/s

The negative sign indicates that the momentum of the ball decreased during the collision with the wall.

Learn more about momentum:

https://brainly.com/question/18798405

#SPJ11

Consider the following hypothetical reactions:
A→BΔH=+25kJ
B→CΔH=+58kJ
You may want to reference (Pages 184 - 186) Section 5.6 while completing this problem.
Part A
Use Hess's law to calculate the enthalpy change for the reaction A→C.
Express your answer using two significant figures.

Answers

The enthalpy change for the reaction A → C is +83 kJ.

We can add the enthalpy changes for the individual reactions to obtain the enthalpy change for the overall reaction:

A → B ΔH = +25 kJ

B → C ΔH = +58 kJ

A → C ΔH = (A → B ΔH) + (B → C ΔH)

A → C ΔH = +25 kJ + (+58 kJ)

A → C ΔH = +83 kJ

Enthalpy is a fundamental concept in thermodynamics that refers to the total energy of a system. It is defined as the sum of the internal energy of the system and the product of its pressure and volume. Enthalpy is represented by the symbol H and is often used to describe the heat content of a substance at constant pressure.

Enthalpy plays a critical role in chemical reactions as it provides information on the amount of heat that is released or absorbed during a reaction. When a chemical reaction occurs at constant pressure, the change in enthalpy (ΔH) can be used to determine whether the reaction is exothermic (releases heat) or endothermic (absorbs heat). Enthalpy is measured in units of joules (J) or kilojoules per mole (kJ/mol). It is also commonly expressed in terms of enthalpy changes (ΔH), which can be calculated by subtracting the initial enthalpy from the final enthalpy of a system.

To learn more about Enthalpy visit here:

brainly.com/question/16720480

#SPJ4

The enthalpy change for the reaction A → C is +83 kJ.

We can add the enthalpy changes for the individual reactions to obtain the enthalpy change for the overall reaction:

A → B ΔH = +25 kJ

B → C ΔH = +58 kJ

A → C ΔH = (A → B ΔH) + (B → C ΔH)

A → C ΔH = +25 kJ + (+58 kJ)

A → C ΔH = +83 kJ

Enthalpy is a fundamental concept in thermodynamics that refers to the total energy of a system. It is defined as the sum of the internal energy of the system and the product of its pressure and volume. Enthalpy is represented by the symbol H and is often used to describe the heat content of a substance at constant pressure.

Enthalpy plays a critical role in chemical reactions as it provides information on the amount of heat that is released or absorbed during a reaction. When a chemical reaction occurs at constant pressure, the change in enthalpy (ΔH) can be used to determine whether the reaction is exothermic (releases heat) or endothermic (absorbs heat). Enthalpy is measured in units of joules (J) or kilojoules per mole (kJ/mol). It is also commonly expressed in terms of enthalpy changes (ΔH), which can be calculated by subtracting the initial enthalpy from the final enthalpy of a system.

To learn more about Enthalpy visit here:

brainly.com/question/16720480

#SPJ4

a 3.77 uf capacitor is connected to a 240v ac source with a frequency of 447 hz. What is the rms current in the capacitor?

Answers

A 3.77 [tex]\mu f[/tex] capacitor is connected to a 240v ac source with a frequency of 447 hz. The rms current in the capacitor is 0.224 A.

Plugging in the given values, we have:

Xc = 1 / (2π * 447 Hz * 3.77 μF) = 758.1 Ω

Now, we need to calculate the root-mean-square voltage of the AC source, which is given by:

Vrms = Vpeak / √2

where Vpeak is the peak voltage of the AC source, which is given by:

Vpeak = 240 V

So, we have:

Vrms = 240 V / √2 = 169.7 V

Finally, we can calculate the rms current in the capacitor using the formula:

Irms = Vrms / Xc = 169.7 V / 758.1 Ω = 0.224 A (rounded to three significant figures)

Frequency refers to the number of times that a particular event occurs within a given time frame. It can be used to describe a wide range of phenomena, from the number of times a particular word appears in a text to the number of waves that pass a particular point in a second. In physics, frequency is often used to describe the rate at which a wave oscillates, which is measured in Hertz (Hz). This is important in fields such as acoustics and optics, where the frequency of a wave determines its pitch or color, respectively.

Frequency is also an important concept in statistics, where it is used to describe the distribution of values within a dataset. The frequency of a particular value refers to the number of times that value occurs within the dataset. This information can be used to create frequency distributions, which provide a visual representation of how often different values appear within a dataset.

To learn more about Frequency visit here:

brainly.com/question/29739263

#SPJ4

at what energy do approaching protons interact with the individual nucleons instead of the mean field of the nucleus

Answers

The energy at which approaching protons interact with the individual nucleons instead of the mean field of the nucleus is called the delta resonance excitation energy.

The pion production threshold attraction speed is nearly  140-200 MeV for light nuclei like Helium, and Hydrogen and increases up to 500 MeV. The energy at which the proton center is the collective effect of nucleons in the nucleus.

The energy is in a higher energy state which further causes the formation of delta resonance relevant in many parts of electrons. This resonance further emits a pion, leading to the interaction between protons and nucleons than the nucleus.

To learn more about resonance

https://brainly.com/question/30714216

#SPJ4

An experimentalist claims to have raised the temperature of a small amount of water to 150C by transferring heat from high-pressure steam at 120C. Is this a reasonable claim? Why? Assume no refrigerator or heat pump is used in the process

Answers

When compared to its source, which is at 120 degrees Celsius, the water's temperature rises to 150 degrees Celsius. 120 ∘ C . This is an infraction of the second law of thermodynamics, which states that heat cannot be moved from a low to a high temperature without producing an outside impact, such as a heat pump.

What exactly are reservoirs of thermal energy?

When a significant amount of heat is added to or removed from a thermal reservoir, also known as a thermal energy reservoir or thermal bath, the temperature of the reservoir varies only slightly.

What is thermal energy, and how can it be used?

Molecules moving within an object or substance are said to be moving with thermal energy. The thermal energy of any material or item.

To know more about heat pump visit:-

https://brainly.com/question/13198025

#SPJ1

What is the magnitude and direction of the force exerted on a 3.50 µC charge by a 250 N/C electric field that points due east?

Answers

The magnitude of the force exerted on a 3.50 µC charge by a 250 N/C electric field that points due east can be found using the equation F = q E, where F is the force, q is the charge, and E is the electric field.

Plugging in the values, we get:
F = (3.50 × 10^-6 C) × (250 N/C)
F = 0.875 N

Therefore, the magnitude of the force is 0.875 N.

The direction of the force can be found using the right-hand rule. If you point your fingers in the direction of the electric field (due east in this case) and then curl your fingers towards the direction of the charge (which we'll assume is positive), then your thumb will point in the direction of the force. In this case, the force will be pointing upwards (perpendicular to the electric field and the charge's motion). So, the direction of the force is upwards.

To know more about magnitude:

https://brainly.com/question/30395926

#SPJ11

a generator produces 290 kw of electric power at 7.2 kv. the current is transmitted to a remote village through wires with a total resistance of 15 ω..
A)
What is the power loss due to resistance in the wires?
Express your answer with the appropriate units.
B)
What is the power loss if the voltage is increased to 30 kV?
Express your answer with the appropriate units.

Answers

The power loss due to resistance in the wires is 24,440.72 watts and the power loss when the voltage is increased to 30 kV is 1,398.15 watts.

A) The power loss due to resistance in the wires can be calculated using the formula P = I^2 * R, where P is the power loss, I is current, and R is the resistance. First, we need to find the current in the wires, which can be calculated using the formula I = P/V, where V is the voltage.

Thus, I = 290,000 W / 7,200 V = 40.28 A.

Substituting this value and the resistance of 15 Ω into the formula for power loss, we get

P = (40.28 A)^2 * 15 Ω = 24,440.72 W.

Therefore, the power loss due to resistance in the wires is 24,440.72 watts.

B) If the voltage is increased to 30 kV, the current in the wires will decrease due to the reduced resistance. To calculate the new power loss, we first need to find the new current generated, using the formula I = P/V.

Substituting the given power and new voltage into this formula, we get I = 290,000 W / 30,000 V = 9.67 A.

Using this value and the total resistance of 15 Ω, we can calculate the new power loss using the formula P = I^2 * R, which gives P = (9.67 A)^2 * 15 Ω = 1,398.15 W.

Therefore, the power loss due to resistance in the wires when the voltage is increased to 30 kV is 1,398.15 watts. This shows that increasing the voltage can significantly reduce the power loss in the wires.

Learn more about Resistance:

https://brainly.com/question/17563681

a 70.0-cm-diameter cyclotron uses a 530 v oscillating potential difference between the dees.

Answers

A cyclotron is a type of particle accelerator that uses a magnetic field to accelerate charged particles. In a 70.0-cm-diameter cyclotron, there are two metal dees that are shaped like the letter "D" and are positioned facing each other with a gap in between.

The dees are connected to an oscillating potential difference of 530 volts, which creates an electric field that oscillates between the two dees.

Charged particles are injected into the center of the cyclotron and are accelerated by the electric field as they move back and forth between the dees.

As the particles gain energy, they spiral outwards towards the edge of the cyclotron due to the magnetic field. This causes the radius of their orbit to increase, which in turn allows them to reach higher speeds.

As the particles gain more and more energy, they eventually reach the desired energy level and are ejected from the cyclotron. This process is used in a variety of applications, including medical imaging and cancer treatment, as well as in the study of fundamental particles and their properties.

To know more about cyclotron refer here:

https://brainly.com/question/29740278#

#SPJ11

consider an infinite sheet of parallel wires. the sheet lies in the xy plane. a current i runs in the -y direction through each wire. there are n/a wires per unit length in the x direction.

Answers

The magnetic field is proportional to the current and inversely proportional to the number of wires per unit length in the x direction.

The magnetic field produced by an infinite sheet of parallel wires can be determined using Ampere's Law. Since the current is running in the -y direction through each wire, the magnetic field lines will circulate around each wire in the clockwise direction when viewed from above. The magnitude of the magnetic field at a point above the sheet will depend on the distance from the sheet, as well as the number of wires per unit length in the x direction.
Using Ampere's Law, the integral of the magnetic field around a closed loop will be equal to μ₀ times the current enclosed by the loop. For a rectangular loop with sides of length L and H, the magnetic field along the sides parallel to the wires will be constant and equal to μ₀ times the current per unit length (i/n) times the width of the loop (L), while the field along the sides perpendicular to the wires will be zero. Thus, the integral of the magnetic field around the loop will be 2 times the magnetic field along one of the parallel sides, or 2μ₀(i/n)L.
Setting this equal to μ₀ times the current enclosed by the loop (iLH), we can solve for the magnetic field at a point above the sheet:
B = μ₀i/2n

Learn more about magnetic field :

https://brainly.com/question/23096032

#SPJ11

how many grams of lithium (atomic mass of 6.91 g/mol) are in a lithium-ion battery that produces 4.00 a·h of electricity?

Answers

There are approximately 0.0000413 grams of lithium in a lithium-ion battery that produces 4.00 a·h of electricity.


grams of lithium = (4.00 a·h) x (1 mole of electrons / 96,485 C) x (1 mole of lithium / 1 mole of electrons) x (6.91 g / 1 mole of lithium)
where:
- 4.00 a·h is the amount of electricity produced by the battery
- 96,485 C is the Faraday constant, which relates the amount of electricity to the number of electrons involved in the reaction
- 1 mole of electrons is the number of electrons that flow through the battery during the reaction
- 1 mole of lithium is the amount of lithium involved in the reaction
- 6.91 g is the atomic mass of lithium, which tells us how many grams are in one mole of the element
Plugging in the numbers, we get:
grams of lithium = (4.00 a·h) x (1 mole of electrons / 96,485 C) x (1 mole of lithium / 1 mole of electrons) x (6.91 g / 1 mole of lithium)
grams of lithium = (4.00 a·h / 96,485 C) x 6.91 g
grams of lithium = 0.0000413 g

Learn more about lithium here:

https://brainly.com/question/29018267

#SPJ11

a force f = (-30, 50) n acts on a mass of 10 kg. at time t = 0 s, the mass has a velocity v0 = (-2, -5) m/s. what are the (x,y) components of the velocity vector (in m/s) after 4 seconds?

Answers

We'll add the initial velocity (v0 = (-2, -5) m/s) to the result: vf = v0 + a * t = (-2, -5) m/s + (-12, 20) m/s = (-14, 15) m/s So, the (x, y) components of the velocity vector after 4 seconds are (-14, 15) m/s.

To find the (x,y) components of the velocity vector after 4 seconds, we need to use the formula:

v = v0 + (f/m)t

where v is the final velocity, v0 is the initial velocity, f is the force acting on the mass, m is the mass, and t is the time elapsed.

Plugging in the given values, we have:

f = (-30, 50) N
m = 10 kg
v0 = (-2, -5) m/s
t = 4 s

To find the x-component of the velocity vector, we can use:

vx = v0x + (fx/m)t

where vx is the x-component of the velocity vector, v0x is the initial x-component of the velocity, fx is the x-component of the force, and t is the time elapsed.

Plugging in the values, we have:

vx = -2 + (-30/10) x 4
vx = -2 - 12
vx = -14 m/s

To find the y-component of the velocity vector, we can use:

vy = v0y + (fy/m)t

where vy is the y-component of the velocity vector, v0y is the initial y-component of the velocity, fy is the y-component of the force, and t is the time elapsed.

Plugging in the values, we have:

vy = -5 + (50/10) x 4
vy = -5 + 20
vy = 15 m/s

Therefore, the (x,y) components of the velocity vector (in m/s) after 4 seconds are (-14, 15).

Learn more about velocity here:

https://brainly.com/question/30559316

#SPJ11

Solenoids and Toroids If a current is 2.0 A, how many turns per centimeter must be wound on a solenoid in order to produce a magnetic field of within it?

Answers

318 turns per centimeter must be wound on a solenoid in order to produce a magnetic field of within it If a current is 2.0 A.

To determine the number of turns per centimeter needed to produce a magnetic field within a solenoid with a current of 2.0 A, we need to know the desired strength of the magnetic field. Additionally, it's important to note that solenoids are cylindrical coils of wire that produce a magnetic field when a current passes through them. Toroids, on the other hand, are donut-shaped coils of wire that also produce a magnetic field.

Assuming we want a magnetic field strength of 1 tesla within the solenoid, we can use the equation

B = μ[tex]_0[/tex] × n × I

where B is the magnetic field strength, μ[tex]_0[/tex] is the permeability of free space (4π x [tex]10^-^7[/tex]Tm/A), n is the number of turns per unit length, and I is the current.

Rearranging this equation to solve for n, we get n = B / (μ[tex]_0[/tex] × I).

Plugging in the values given, we get

n = (1 T) / (4π x [tex]10^-^7[/tex] Tm/A × 2.0 A) = 3.18 x [tex]10^6[/tex] turns/meter.

To convert this to turns per centimeter, we divide by 100, which gives us 3.18 x [tex]10^4[/tex] turns/cm.

Therefore, to produce a magnetic field of 1 tesla within a solenoid with a current of 2.0 A, we need to wind approximately 31,800 turns per meter, or 318 turns per centimeter.

To know more about Magnetic field refer here :

https://brainly.com/question/14411049

#SPJ11

what is the water pressure as it exits into the air? express your answer with the appropriate units.

Answers

Water pressure varies, but is typically measured in psi or kPa and ranges from a few to several hundred.

The water tension as it exits out of sight relies upon a few variables, including the level of the water source and the size of the opening. The strain can be determined utilizing the Bernoulli condition, which expresses that the tension of a liquid declines as its speed increments.

Expecting a water source at ground level and dismissing any frictional misfortunes, the tension can be approximated as

[tex]P = 0.5rhov^2,[/tex]

where P is the strain in Dad, rho is the thickness of water (1000 [tex]kg/m^3[/tex]), and v is the speed in m/s. For instance, on the off chance that the water is leaving at a speed of 10 m/s, the tension can be determined as P = 0.51000([tex]10^2[/tex]) = 50,000 Dad, or roughly 7.25 psi. Notwithstanding, the genuine strain can fluctuate generally contingent upon the particular conditions.

To learn more about pressure and kPa, refer:

https://brainly.com/question/31493200

#SPJ4

The complete question is:

Part A Water flows from the pipe shown in the figure with a speed of 8.0 m/s . (Fiaure 1) What is the water pressure as it exits into the air? Express your answer to two significant figures and include the appropriate units. HA Value Units p= 1 Value Units.

Other Questions
Match the following. Match the items in the left column to the items in the right column.1. set builder notation2. element3. set4. line graph5. inequality6. real numbera shorthand way to write a set(less than), (greater than), (less thanor equal to), (greater than or equal to)visual tool used to illustrate solutionsetsa collection or group of objectsindicated by braces, (a member of a setpositive or negative, rational orirrational numbers including zero The addition of concentrated nitric acid to each standard solution... Select all that are True. O results in a relatively constant ionic strength across the standard solutions. O results in the required amount of excess nitrate ion. O changes the potential of the reference electrode. O results in an ultraviolet digestion to ensure sample dissolution. O results in a wet acid digestion to ensure sample dissolution. Unit 9 lesson1 7th grade math math nation pt.2 Can somebody do this, please?! 10. describe three similarities between mitosis and meiosis. a. 11. describe three ways the outcome of mitosis and meiosis differ. a first order reaction has a rate constant of 1.10 x 10-4 s-1 at 470oc, and 5.70 x 10-4 s-1 at 500oc. what is the activation energy for the reaction?a. 260 kJ/mol b. 46 kJ/mo c. 110 kJ/mol d. 380 kJ/mol The French experience in New France was similar to the Spanish experience in New Mexico in all of the following ways, EXCEPT...Group of answer choicesImperial influence was expanded by conquering native peoplesLow level immigrationDependence upon the native peoplesInter-racial marrying and social integration Express cos M as a fraction in simplest terms. Multiple energy storage methods are in use around the world. Pumped hydroelectric is a common energy storage method in the United States that pumpswater into a storage pond raised above another water source and then allows the water to flow downhill through a turbine to generate electricity. How is theenergy stored in pumped hydroelectric facilities?O as kinetic rotational energyO as stored chemical energyO as thermal energyO as gravitational potential energy When light enters and leaves the prism, its path is changes because the light is _____ at the boundary between the glass and the airA. Absorbed B. DiffractedC. ReflectedD. Refracted Sheridan Company is considering an investment that will return a lump sum of $929,000 6 years from now. CWhat amount should Sheridan Company pay for this investment to earn an 8% return? (Round answer to 2 decimal places, eg. 25.25.)Lincoln Company should pay $ ___Wildhorse Co.earns 8% on an investment that pays back $87,000 at the end of each of the next 6 years.What is the amount Wildhorse Co. invested to earn the 8% rate of return? (Round answer to 2 decimal places, eg. 5,275.25.) Wildhorse Co. invested $ ___ compare and contrast the expansionist policies of the russian state with those pursued by the british and french regimes during this period. let x have the following cumulative distribution function (cdf): f(x)={0,x Gary deposited $9,000 in a savings account with simple interest. Four months later, he had earned $180 in interest. What was the interest rat (conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil? Which of the following statements is the best description of the per capita generation of solid waste between 1960 and 2010?ANSWER:a.Between 1960 and 2010, per capita generation was relatively constant.b.Between 1960 and 2010, per capita generation of solid waste increased steadily.c.Between 1960 and 2000, per capita generation increased.After 2000, per capita generation declined.d.Between 1960 and 1990, per capita generation increased at a steady rate. After 1990, per capita generation continued to increase, but at a slower rate. find the running time equation of this program: def prob6(l): if len(l)