What does this image
reveal about the
interaction between
people during the Age of
Exploration?

What Does This Imagereveal About Theinteraction Betweenpeople During The Age OfExploration?

Answers

Answer 1

The inference is that the image shows the Portuguese traders in Nagasaki and this was an interaction between people during the Age of Exploration.

What is an inference?

An inference simply means the conclusion that can be deduced based on the information given in a literary work.

In this case, the inference shows the interactions among the Portuguese traders in Nagasaki. This was vital to the development of the economy.

Learn more about inference on:

brainly.com/question/25280941

#SPJ1


Related Questions

how did the vietnam war cause a division in the american people

Answers

Answer:

The American people had a disagreement about the government

Explanation:

some American people believed the war symbolized unchecked authority, which they resented. While the other American people believed it would be treasonous if they went against the government.

can you help me fast

Answers

Answer:

Explanation:

1 blank federalism

2 blank coin money, regulate the mail, declare war, or conduct foreign affairs.

3 blank Establish local governments.

Issue licenses (driver, hunting, marriage, etc.)

Regulate intrastate (within the state) commerce.

Conduct elections.

Ratify amendments to the U.S. Constitution.

Provide for public health and safety.

4 blank Concurrent powers

Who made the decision to drop the atomic bomb on japan.

Answers

Harry Truman made the decision

match it to the correct answer

Answers

Answer:

1. Anti-Semitism

2. Conscientious Objectors

3.  Kamikaze Pilots

4. Interment Camp

Which of these situations is an example of state capitalism

Answers

The government acts as a capitalist by owning and operating important sectors of the economy

Previous Page
Next Page
Page 34
Question 34 (3 points)
In the quote below, Mao is referring to which economic program?
"Wage a bitter struggle for three years and transform the look of a greater part of the
country... The industrial output of local industries should exceed local agricultural
output in five to ten years."
-----Mao Zedong, 1958
The Cultural Revolution
The Great Leap Forward
The Five-Year Pland

Answers

The economic program that Mao Zedong was referring to here was B. The Great Leap Forward

What is the Great Leap Forward

This refers to the period in Chinese history that brought about a five-year plan that was meant to meet the country's agricultural needs.

Hence, we can see that based on the given quote by Mao Zedong about the five-year plan that would bring suffering at first but would transform the country, he was referring to The Great Leap Forward

Read more about The Great Leap Forward here:

https://brainly.com/question/12360189

#SPJ1

How did urban flight change the nation’s cities?

Answers

The way that urban flight changed the nation's cities was by causing gentrification to happen.

What did urban flight lead to?

Urban flight refers to a situation where people who stay in cities move to other areas which are more rural in nature.

As a result of this, more areas were left up for sale and wealthier people bought them up which led to gentrification.

Find out more on gentrification at https://brainly.com/question/14305750.

#SPJ1

Which development prompted US intervention in the 1973 Chilean coup? A. physical threats to Americans living in the country B. a desire to open lines of trade with South American countries C. President Allende’s plan to nationalize US-owned companies D. opposition leader Pinochet’s history of cooperation with the United States

Answers

US intervention in the 1973 Chilean coup was occasioned by  President Allende’s plan to nationalize US-owned companies.

What was the 1973 Chilean Coup?

   The 1973 Chilean coup d'état was a military coup in Chile that deposed the  Unity government of President Salvador Allende.

 This coup was covertly planned by the CIA in an effort to protect American Interest in Latin America.

  In order to prevent the spread of socialism in Latin America, president Kennedy conceived the idea of economic and infrastructural development in Latin America.

  President Allende tried to Nationalize two copper industries (Anaconda and Kennicott) both of which were headquartered in the US and hence the American intervention.

Learn more about the Chilean coup at https://brainly.com/question/26774879

#SPJ1

6
7
10
As in Europe, the growth of industrialization in the United States occurred
in large cities.
Oregionally.
Oby state.
Onationally.
a

Answers

make the question clear its not clear what you want

In brown v. Board of education of topeka, the supreme court ruled that it was.

Answers

Answer:

Unconstitutional

Explanation:

In this case, the court ruled limiting students from attending certain school because of their race was violating the 14th amendment.

Answer:Unconstitutional

Explanation:

Which two sentences best support the inference that parts of New Mexico have remained the same despite experiencing many changes?
Part of the "Old West," New Mexico was once a place commonly known for cowboys and cattle drives.
It also presents other styles that have influenced New Mexico: hip-hop, Latin, and Matachine.
The influence of these tribes is evident in the artwork, architecture and culture throughout the state.
The capital city of Santa Fe, founded in 1610, has the oldest continually used seat of government in North America.
In 1540, the Spanish conquistador Coronado trekked through the area known today as New Mexico in search of the fabled seven cities of gold.

Answers

Answer:

New Mexico is a comparatively poor state, ranking among the lowest in the country in per capita income. About one-half of its economy is based on the service sector, while much of the remainder is centred on extractive industries (mining and oil production). Relying heavily on the export of raw materials and on federal expenditures for programs of no certain permanence, New Mexico is subject to shifting demands from outside the state. Government spending accounts for nearly one-fourth of the state’s economy.

Explanation:

New Mexico is a comparatively poor state, ranking among the lowest in the country in per capita income. About one-half of its economy is based on the service sector, while much of the remainder is centred on extractive industries (mining and oil production). Relying heavily on the export of raw materials and on federal expenditures for programs of no certain permanence, New Mexico is subject to shifting demands from outside the state. Government spending accounts for nearly one-fourth of the state’s economy.

How was the new government of the United States similar to the government under British rule

Answers

Answer:

The official British reply to the colonial case on representation was that the colonies were “virtually” represented in Parliament in the same sense that the large voteless majority of the British public was represented by those who did vote. To this Otis snorted that, if the majority of the British people did not have the vote, they ought to have it. The idea of colonial members of Parliament, several times suggested, was never a likely solution because of problems of time and distance and because, from the colonists’ point of view, colonial members would not have adequate influence.

is it possible to be both a nationalist and a communist?

Be detailed and in your own words. Giving out brainliest.

Answers

Answer:

Yes

Explanation:

As communism is an ideology dedicated to the establishment of classless societies centered around worker ownership of the means of production, communists do not necessarily want to abolish the concept of the nation as a means of uniting a people. However, most communists currently will reject nationalism in favor of internationalism, as part of the liberation of the working peoples. There are many examples of communist leaders emphasizing nationalism, however, such as Hồ Chí Minh of Vietnam and Enver Hoxha of Albania.

Theseus symbolizes power and order in the city of _______ in the play. Question 2 options: Athens Turkey Rome London

Answers

The character of Theseus symbolizes the power and order in the city of Athens in Greek.

Who is Theseus?

This is a character that ruled Athens and represents the voice of law and authority in the mortal realm

Thesus is said to paralleled Oberon's similar position in the fairy world and symbolizes the power and order in the city of Athens in Greek.

Therefore, the Option A is correct.

Read more about Theseus

brainly.com/question/16618015

#SPJ4

The harlem renaissance was influenced by the migration of african american citizens a. from southern cities to western cities, including los angeles and san francisco. b. from southern cities to northern cities, including new york, chicago and st. louis. c. from northern cities to southern cities, including atlanta and charlotte. d. from east coast cities such as boston to midwest cities such as detroit. please select the best answer from the choices provided a b c d

Answers

The Harlem Renaissance was influenced by the migration of African American citizens from southern cities to northern cities, including new york, Chicago, and st. Louis. Option B. This is further explained below.

What is Harlem renaissance?

Generally, Harlem renaissance  In the 1920s and 1930s, the Harlem Renaissance was a period of unprecedented growth in African-American culture, notably in the creative arts.

In conclusion, The movement of African Americans from southern cities to northern ones, such as New York, Chicago, and St. Louis, impacted the Harlem Renaissance.

Read more about Harlem renaissance

https://brainly.com/question/9195022

#SPJ1

True or False: The Emancipation Proclamation was issued after a Union victory at Antietam.

Answers

Answer:

true

Explanation:

It was for boosted moral and help for enslaved Africans after antitem.

How does terrorism affect the world today?

Answers

Answer:

because thiers alot of stuff happening in this world and alot of things will happend every dsy

the earliest native american civilization in mexico was that of the

Answers

The Olmecs was the earliest native american civilization in Mexico.

Who are the Olmecs?

This is the first civilization of its kind in Mesoamerica that greatly influenced other cultures' development in the region.

The region of the civilization covered the present. southern Mexico, Guatemala, and Honduras.

Read more about Olmecs

brainly.com/question/1697544

#SPJ1

Question 8 of 20
What is the relationship between historical questions and historical
arguments?
A. Historical questions provide evidence to support historical
arguments.
B. Historical questions are used to turn historical arguments into
essays.
C. Historical arguments are formed to answer historical questions.
D. Historical arguments connect multiple historical questions.

Answers

C. Historical arguments are formed to answer historical questions

Consider the part of the poem you just read. What do you
think is most likely to happen to Thisbe next? Write your
response in one to two sentences.

Answers

The poem is “Ovid’s Metamorphoses”. The things that will happen next are that Thisbe is going to make it to cave safely but will be attacked by the lioness.

What is Poem?

A poem is a short piece of text divided into lines. Words and a collection of ideas, imagination, emotions, and feelings are used by the poet to express the poetry.

The poet sends a message to the reader based on the story about a person who isn't brave in terms of physical strength and outer beauty. They have the courage of their convictions and the self-assurance to make a difference.

As a result, Thisbe next sentences is going to make it to cave safely but will be attacked by the lioness.

Learn more about on poem, here:

https://brainly.com/question/21087323

#SPJ1

In what way does the painting Stormy Coast Scene after Shipwreck demonstrate the ideals of romanticism

Answers

Answer:

it illustrates the chaotic quality of nature

Explanation:

Romanticism was a literary and artistic movement that placed a premium on the expressiveness of the individual and the transformative potential of nature. It represented a backlash against the rationalist ideals of the Enlightenment.

Who painted the image above?​

Answers

Answer:

Painting by Pablo Picasso

Answer:

The painting is by Pablo Picasso

Explanation:

It is called the gunerica

Do you think that leaders will always have things they want to hide, Explain?
NEED ASAP

Answers

Yes, if the prez shared all state secrets with the public the nation would be incredibly embarrassed, offensive and divided.

Why did workers organize strikes in the early 1800s?
2of3 QUESTIONS
Workers wanted to force their employers to raise their pay.
Workers went on strike to fight against trade unions.
O Courts would only support workers if they went on strike.
Factory owners usually gave in to demands if workers went on strike.

Answers

Answer:

Workers wanted to force their employers to raise their pay.

ILL GIVE BRAINLIEST!
In your own words, describe Image A. What kind of printing technology is being used in this image?

Answers

Answer:

Image A seems to be a manual printing method that was used centuries ago

Explanation:

The image is clearly old, and shows a man writing things from one paper onto another

How will this plan bring about justice after the civil war?

Answers

Answer:

la verdad es que me vale madres esta wea

this question doesn’t make sense

what did imperialism have om the united states in the late 1800s and early 1900s

Answers

Answer:

d) The United States established trade agreements with Europe and

South America.

Explanation:

The Spanish-American War was finally put to rest when the Treaty of Paris was signed in December 1898 and approved by Congress in February 1899. During this time, Cuba achieved its freedom and Spain gave over Puerto Rico, Guam, and the Philippines to the United States. The "Open Door" strategy was an important initiative by the McKinley administration that attempted to advance U.S. business interests in China and keep the United States competitive internationally. McKinley's ambitious foreign policy allowed the United States to get more involved in international issues.

The U.S. finally granted independence to the Philippines in 1946.

When a company hires people in another country to do work for them, it is called what?

a. monopolization
b. outsourcing
c. incorporation
d. profit sharing

Answers

When a company hires people in another country to do work for them, it is called b. outsourcing.

What is outsourcing ?

Outsourcing can be regarded as a process that is been used by an organization to seek for those that can handle some specific task for them outside the organization.

It should be noted that Most of the organization usually do this so they can get access to cheap labour.

Learn more about outsourcing here:brainly.com/question/26497267

#SPJ1

Answer:

Outsourcing

Your welcome :D

Tennyson's poem and waterhouse's painting both depict this fictional event

Answers

The Tennyson's poem and water house painting both depict the difficult situation of a young woman, who is isolated under a curse.

What is the summary of the Tennyson's poem?

In Tennyson's poem, The Lady of Shalott is a painting that speaks a lot about the woman who is restricted to her quarter only.

She has been cursed and is not allowed to go outside of her place. Only the thing she can do is to look the world through the window.

She is watching the world through the reflection.

Learn more about the Tennyson's poem here:-

https://brainly.com/question/16815503

#SPJ1

A person studying macroeconomics would be most interested in:
a. identifying the factors that help people become wealthy.
b. analyzing the spending habits of two different families.
c. comparing the national debt held by two countries.
d. understanding how businesses form monopolies.

Answers

An individual would be more interested while studying macroeconomics in the comparison of national debt owned by two countries.

Option C is the correct answer.

What is macroeconomics?

Macroeconomics is the field of economics that covers all the economic factors affecting a country.

While studying macroeconomics, the individual gets to know about the factors that affect a nation's economy. These factors can be the inflation situation, national income, Gross domestic product, levels of unemployment, and many more.

Therefore, the explanation provided in part C is the correct option.

Learn more about macroeconomics in the related link:

https://brainly.com/question/23788392

#SPJ1

Other Questions
Consider the soccer ball is kicked toward a goal at a speed of 35 mph and an angle of 25 from horizontal, what is the maximum height the ball will reach? Is this height more than a standard soccer goal's height, which is 8 feet from the ground? (Recall: 1 mile = 1,609 meters and 1 hr = 3,600 s and 1 ft = 0.3048 meters) In dry climates, ________ is a common mechanical weathering process. A) exfoliation B) frost wedging C) salt wedging D) carbonation Read these lines from Fredrick Douglass's speech "What to The Slave Is the Fourth of July?"The blessings in which you this day rejoice, are not enjoyed in common.Which of the following correctly defines the word common as it is used here?Of ordinary occurrence; usualOf the most familiar typeO Falling below ordinary standardsShared alike by all the persons in question HELP ME CJDUCIF PLEASE I WILL MARK BRAINLIST You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units