What is human cell and define function ?

Answers

Answer 1

Cells in the human body number in the trillions and come in all shapes and sizes. These tiny structures are the basic unit of living organisms .The body contains around 50—100 trillion cells, and they vary widely in size, number, structure, and use.

Examples of Human Cell Types-

Many common types of human cells — such as bone cells and white blood cells — actually consist of several subtypes of cells. Each subtype, in turn, has a special structure and function.

Functions of human cell-

It protects the cell.It regulates the exchange of substances in and out of the cell.They process and bundle macromolecules in the cells.They modify, sort, and package proteins. That’s why Golgi bodies are tagged as the post office of the cell. They gather simple molecules and group them to form a complex.

For more information about human cells see,

https://brainly.com/question/2506220

Answer 2

Different types of cells are found in the human body which perform specialized functions such as circulation, respiration, excretion, transportation, etc.

What is Human cell?

Human bodies are made up of eukaryotic cells. Cells are the basic building blocks of all the living things including animals, plants, fungi, and protists. The human body is composed of over trillions of cells. These cells provide structure for the body, take in nutrients from the food they eat, convert those nutrients from food into energy, and also carry out specialized functions.

Different types of cells which perform specialized functions in the human body include: stem cells, these are the embryonic stem cells and adult stem cells, one cells including osteoblasts, osteoclasts, osteocytes, skin cells including keratinocytes, melanocytes, merkel cells, langerhans cells, endothelial cells such as those lining blood vessels, and epithelial cells such as those lining body cavities.

Learn more about Human cell here:

https://brainly.com/question/276208

#SPJ2


Related Questions

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Answers

Anwser: Methionine-Proline-Glutamate.

The chain of amino acids would be produced by the given sequence of mRNA is as follows:

Tyr-Tyr-Ala, Val-Asn-Cys.

What do you mean by Amino acids?

Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.

The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.

Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.

To learn more about Amino acids, refer to the link:

https://brainly.com/question/14351754

#SPJ2

In the process of , DNA is used as a template for making another type of nucleic acid called . The process begins when the enzyme binds to a region called the .


Answers

In the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.

What is transcription?

Transcription is a genomic process in which RNA is generated from DNA. This will generate an mRNA that will contain the genetic information of the protein that the gene encodes.

Transcription will be generated in the nucleus of the cell, there the RNA polymerase will bind to the DNA in the promoter to begin to generate the RNA copy, generating a transcription bubble to generate the RNA.

The transcription is preceded by the traduction that will take place in the cytoplasm of the cell to generate proteins from the mRNA.

Therefore, we can confirm that in the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.

To learn more about transcription visit: https://brainly.com/question/14136689

#SPJ1

More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause

Answers

A sharp increase in capillary hydrostatic pressure would directly cause an increase in fluid movement to the interstitial spaces.

Capillary hypertension causes the production of a protein-poor ultrafiltrate, which when it enters the interstitial space increases the amount of the interstitial fluid.

A rise in small artery, arteriolar, or venous pressure raises capillary hydrostatic pressure, which favors filtration. Fluid filtration will be reduced if the hydrostatic pressure gradient (PC - Pi) reduces due to an increase in interstitial pressure. Large rises in tissue interstitial pressure, on the other hand, can cause tissue damage and cellular death.

Edema occurs when plasma oncotic pressure falls, hydrostatic pressure rises, capillary permeability rises, or a combination of these variables occurs. When lymphatic flow is impeded, edema can develop.

For more information on capillary hydrostatic pressure, visit :

https://brainly.com/question/28274088

#SPJ4


Body Systems
Which body system
transports oxygen and
nutrients to the body and
aids in the removal of
carbon dioxide and other
waste products?

Answers

Answer:

it would be The circulatory system

Explanation:

because it said transports oxygen and it the circulatory carry blood away towards the heart.

What was one strength of Darwin's theory?

a. He knew about genetics.
b. He knew that species change quickly in spurts.
c. A large amount of data supported his work.
d. He knew that some organisms reproduce at a greater rate than others.

Answers

Answer: C. A large amount of data supported his work.

Darwin did not know that genetics existed, but he did collect evidence from birds with a common ancestor and theorized that they split because of evolution.

Have a good day!

The one strength of Darwin's theory is the large amount of data which is supported by his work. Thus, the correct option is C.

What is Darwin's theory?

Darwin proposed a theory which describes that a species can change over time, that a new species come from the pre-existing species, and that all the species share a common ancestor. In this model of Darwin, each species has its own unique set of heritable or genetic differences from the common ancestor, which have been accumulated gradually over a period of very long period of time.

Darwin used multiple lines of evidence to support his theory of evolution of population through natural selection such as fossil evidence, biogeographical evidence, and anatomical evidence. The one strength of Darwin's theory is the large amount of data which is supported by his work.

Therefore, the correct option is C.

Learn more about Darwin's theory here:

https://brainly.com/question/25718754

#SPJ2

eweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeewewee

Answers

Answer:ewe

Explanation:

ewe.

yup exactly true so true

review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.

Answers

Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.

The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.

A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.

To learn more about genotypes and phenotypes here

https://brainly.com/question/20730322

#SPJ4

Which of the following statements about dinoflagellates is false?
A) They possess two flagella.
B) Some cause red tides.
C) their walls are composed of cellulose plates.
D) Many types contain chlorophyll.
E) Their fossil remains form limestone deposits.

Answers

The false statement about dinoflagellates is their fossil remains form limestone deposits.

Thus, the correct answer is E.

What are dinoflagellates?

Dinoflаgellаtes аre motile unicellulаr аlgаe chаrаcterized by а pаir of flаgellаe. Mаny dinoflаgellаtes аre photosynthetic, whereаs others аre mixotrophic. Whereаs most аre strictly mаrine, some dinoflаgellаtes occupy brаckish аnd freshwаter environments.

Dinoflаgellаtes аlso exhibit remаrkаble trаits: In аddition to chlorophyll, some possess cаrotenoid pigments (dinoxаnthin аnd peridinin), giving them а flаmboyаnt red colorаtion, whereаs others аre bioluminescent. Some species form blooms in the oceаns, а phenomenon cаlled “red tide” due to colorаtion of the wаter resulting from the intense concentrаtion of аlgаl cells. Dinoflаgellаtes аre encrusted with plаtes mаde of а cellulose-like mаteriаl аnd silicа.

For more information about dinoflagellates refer to the link:

https://brainly.com/question/28902387

#SPJ4

The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biosphere

Answers

Answer:

The correct answer is D) Biosphere. The biosphere is the part of the earth that supports life. It includes all of the living organisms on earth, as well as the air, water, and soil that they depend on. The lithosphere, hydrosphere, and atmosphere are also important parts of the earth, but they do not directly support life in the same way that the biosphere does.

Explanation:

which of the following is not true about the cell membrane

Answers

Phospholipid heads are negative and attracted to water is not true about the cell membrane.

The heads aren’t the same thing they are a bit different than what you see at the end and the end but the head has a lot to do with the shape of the head and the shape of the body and the shape it is in the body and the body is the

The _____ control(s) the force of a movement, whereas the_____ control(s) the timing and accuracy of the movement.a.motor cortex; basal gangliab.basal ganglia; motor cortexc.basal ganglia; cerebellumd.cerebellum; basal ganglia

Answers

The basal ganglia A movement's force is controlled by the cerebellum, while its timing and accuracy are controlled by the cerebellum.

What determines a movement's force?

The Motor Complex The brain is in charge of all voluntary actions of the body. The motor cortex is one of the parts of the brain that is most crucial in regulating these voluntary movements.

What function does the basal ganglia play in motor control?

The network of brain cells and nerves that manages your body's voluntary motions includes the basal ganglia as a significant component. Your brain sends movement signals that they can either approve or reject, screening away erroneous or superfluous impulses.

To know more about basal ganglia visit :-

https://brainly.com/question/4109433

#SPJ4

This plant group does not require water for sexual reproduction. this plant group does not require water for sexual reproduction. nonvascular plants seedless vascular plants seed vascular plants all of the above none of the above

Answers

because it is having asexual reproduction

4. As food travels through the digestive system, it is exposed to a variety of pH
levels. The stomach has a pH of 2 due to the presence of hydrochloride acid (HCI),
and the small intestine has a pH ranging from 7 to 9. HCI converts pepsinogen into
pepsin, an enzyme that digests proteins in the stomach. Which of the following most
likely happens to pepsin as
it enters the small intestine?
A. It becomes inactive.
B. It begins to replicate.
C. It's shape changes to engulf large proteins.
D. It's activity increases
to digest more proteins.

Answers

A, it becomes inactive, it is no longer effective in the small intestines

Describe the four layers of the Earth and the response of at least three sentences name at least one important quality of each layer

Answers

Answer: the four layers of earth are: the inner core, the outer core, the mantel, and the crust. The inner core contains the heaviest elements and solid metals. The outer core is liquid and not as hot than the inner core. The mantel is the densest its solid but moves and that causes the earth quakes on the surface. The crust is the thinnest which is different under the ocean and on the continents. Its the coolest of all four  and it consists of plates that are moving.

Explanation:

which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. if a restriction enzyme is combined with a piece of dna that contains its restriction site, the result will be restriction fragments. if a restriction site is cut with a restriction fragment, the results will be multiple restriction enzymes. if a restriction fragment is cut with a restriction enzyme, even more restriction fragments will be produced. if a restriction enzyme is cut at its restriction site, the result is one or more restriction fragments.

Answers

The restriction enzymes when combined with the DNA containing restriction sites lead to cuts at those sites yielding restriction fragments. The second statement is correct.

The restriction enzymes are the enzymes that recognize specific sites known as restriction sites. These are enzymes that are found in bacteria and this feature is used as a modern biotechnology tool for genetic editing.

There are two ways the ends are formed after the action of a restriction enzyme. It can form blunt ends or sticky ends. The sticky ends have a region at the end that is single-stranded. This region can then join according to the complementary base pairing with another strand having complementary sticky ends.  

If it is assumed that the RE (restriction) enzyme is not interrupted during the generation of restriction fragments, the resulting restriction fragments would not yield more restriction fragments when re-incubated with the RE enzyme.

A restriction enzyme cuts only at restriction sites forming restriction fragments that do not yield more restriction fragments on subsequent action of the restriction enzyme.

In conclusion, the action of restriction enzymes on DNA gives smaller fragments of DNA. The second option is correct.

Learn more about restriction enzymes here:

https://brainly.com/question/28197487

#SPJ12

the feeling that ejaculation can no longer be controlled is called ejaculatory: a. intervention. b. inevitability. c. excitement. d. orgasm.

Answers

the feeling that ejaculation can no longer be controlled is called ejaculatory: b. inevitability

Sudden infant death syndrome, preterm births and low birth weights, respiratory problems, and cardiovascular problems are more common among the offspring of mothers who ______ during pregnancy.

Answers

Sudden infant death syndrome, preterm births and low birth weights, respiratory problems, and cardiovascular problems are more common among the offspring of mothers who smoked during pregnancy.

Smoking during pregnancy can result in various different types of challenges during birth and mostly results in premature births, babies being born with low weights, or sudden infant death syndrome.

The lungs of infants whose mothers smoked during pregnancy are damaged which causes severe breathing problems in the child. It also causes the child to not develop properly and have respiratory or cardiovascular problems. Women who smoked during pregnancy can also cause severe complications to their own lives at the time of delivery.

To learn more about pregnancy, click here:

https://brainly.com/question/862356

#SPJ4

Name the main layers of a tropical rain forest. What kinds of plants grow in each
layer?

Answers

Answer:

Most rainforests are structured in four layers: emergent, canopy, understory, and forest floor.

a mutation in the HBB gene,which codes for hemoglobin , produces red blood cells that are rigid and sickle shaped (is that beneficial, neutral, or harmful

Answers

Answer: harmful

Explanation:


Normally, red blood cells are flexible and oval-shaped, which allows them to move easily through the blood vessels and deliver oxygen to the body's tissues. However, sickle-shaped red blood cells are inflexible and can become stuck in small blood vessels, blocking the flow of blood and oxygen. This can cause a range of serious health problems, such as pain, infection, organ damage, and even death.

Down syndrome can be observed in a karyotype/karyogram Xray frameshift point mutation

Answers

Down syndrome can be observed in a O karyotype/karyogram O X ray O frameshift point. DNA replication is necessary for all the responses are correct O growth

sort the following protein complexes of the electron transport chain according to whether they are involved in pumping protons across the inner mitochondrial membrane or not.

Answers

A protein complex is a sub-atomic machine that comprises a few proteins (nucleic acids and different particles) that tight spot each other at a similar spot and time (e.g., record factors, histones, polymerases, and so forth.).

An electron transport chain is an assortment of protein edifices and different particles that utilize redox responses to energize an electron from electron givers to electron acceptors while likewise moving protons across a layer. Electrons are moved to start with one particle and then onto the next in the electron transport chain, and the energy delivered during these electron transporters is utilized to frame an electrochemical slope. The put-away energy in the angle is utilized to deliver ATP in chemiosmosis.

For more information on Electron Transport Chain, visit :

https://brainly.com/question/24372542

#SPJ4

NEED HELP DUE TOMORROW

Answers

Dependent variable is the amount of dirt and independent variable is the type of detergent used.

What are variables?

Variables are defined as any characteristics, number or quantity which can be measured . It can also be called as a data item . It is called as variable because they can vary and can have variety of values.

There are three types of variables 1) manipulated variable where in a condition is specified, 2) responding variable which is dependent on manipulated variable 3)controlled variable which do not change

Example of manipulated variables are number of hours spent by a student studying , that of responding variable is result of a student and temperature is an example of controlled variable.

Learn more about variables,here:

https://brainly.com/question/15740935

#SPJ1

where would you except to find the most of the sedimentary rocks on earth

Answers

Chemical sedimentary rocks can be found in many places, from the ocean to deserts to caves. For instance, most limestone forms at the bottom of the ocean from the precipitation of calcium carbonate and the remains of marine animals with shells.

Which of the below terms would be different if the reflex were a balance reflex? What term would you substitute?
Pain receptor, sensory neuron, spinal cord, motor neuron, & effector muscle.

Answers

Answer:you i am minon pituf an red

Explanation:

The region identified by location 4 on the map is classified as belonging to the tundra biome. Which of the following climate graphs most accurately depicts the conditions found in this biome?
A
B
C
D

Answers

Answer:

B

Explanation:

For more proof look at the second image

If a strand of hair has a continuous medulla pattern, and the Medulla Index is 42, what species would it most likely be from?
Cat
Insect
Human
Polar Bear

Answers

Polar bear because it’s white

Answer:

It's a cat

Explanation:

I got it correct on my exam.

When the medulla index is above 33 and has a continuous pattern it's animal hair.

What is the name of the signaling molecules used in endocrine signaling?

Answers

Answer:

The signaling molecules used in endocrine signaling are called hormones. Hormones are chemical messengers that are produced by glands in the endocrine system and released into the bloodstream, where they can circulate throughout the body and regulate the function of various organs and tissues. Some examples of hormones include insulin, thyroid hormone, and estrogen.

Explanation:

Which two conditions will contribute to the stability of drug-target interactions?
Options:
-The potential energy of the drug-target complex is at its lowest

-The shape of the drug molecule fits into the binding pocket of the target molecule

-The diffusion coefficient of the cell is very small

-The internal energy of the molecule is lower than the ambient temperature

Answers

Answer:

Two conditions that can contribute to the stability of drug-target interactions are:

-The shape of the drug molecule fits into the binding pocket of the target molecule. This allows the drug to interact with the target in a specific, complementary way, which can increase the stability of the complex.

-The potential energy of the drug-target complex is at its lowest. This means that the drug and target molecules are interacting in a way that minimizes the overall energy of the system, which can increase the stability of the complex.

pls award brainliest!

Explanation:

I WILL LOVE YOU FOREVER IF YOU ANSWER THIS TONIGHT : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.

Answers

When the dihybrid cross is made between two TtRW plants, then the ratio of genotype produced from this cross will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).

What is inheritance?

Inheritance is the process through which genetic information is passed on from the parents to their offspring. This is possible through the gametes which fuse together to form zygote (2n). This zygote have similar characteristics to both of the parents.

In mendelian inheritance, complete dominance is observed which states that an allele could be completely dominant or completely recessive there is no in between.

However, some exceptions like incomplete dominance and codominance have been found later where, the presence of two contrasting alleles will lead to development of a phenotype which is in between the two.

In the F2 generation of the cross between the TtRW plants. The phenotype ratio will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).

Learn more about Dominance here:

https://brainly.com/question/14053639

#SPJ1

Which of the following would be a reasonable conclusion if hair was found to have a drug in the middle of the strand but not in the rest of the hair strand?
Drug use is not identified.
Drug use is currently happening.
Drug use occurred several weeks ago.
Drug use has occurred for several months.

Answers

Answer:

drug use occurred several weeks ago.

Explanation:

Other Questions
What are the types of committee Organisation? The ______ is a measure of the error in using the estimated regression equation to predict the values of the dependent variable in a sample.A. sum of squares due to regression (SSR)B. sum of squares due to error (SSE)C. erorr termD. residual What are the main features of modernism? Write short note on renewable resources and its importance Write an explicit formula that represents the sequence defined by the following recursive formulaplease help Why does Mark Twain use colloquial speech in his writing? Which 3 of the maintenance activities can help you repair a QuickBooks desktop data file? which of the following can be used to replace/* line 1 */ so that the loop in howmeanisthe pound would access all of the dogs in the arraylist? public class dog Be sure to answer all parts. Draw a mechanism for the following reaction: BrtBuO t-BuO finish structure What type of power does congress have when it changes the price of a postage stamp to deal with rising costs of delivery?. Use multiplication. 4 times what number is about 35? 354 what is the name of the special porridge eaten at christmas eve dinner in many homes in russia? Which of the following is one way in which the White House staff is different from the president's Cabinet?a. The White House staff is not subject to Senate confirmation.b. The Cabinet is more loyal to the president than is the White House staff.c. The Cabinet works more closely with the president than does the White House staff.d. The White House staff must perform their job duties in accordance with congressional legislation, while the Cabinet has no such restraints. A(n) 0.298 kg soccer ball approaches a player horizontally with a speed of 15 m/s. The player illegally strikes the ball with her hand and causes it to move in the opposite direction with a speed of 17 m/s..What is the magnitude of the impulse de- livered to the ball by the player? Answer in units of kg m/s. Principal: 1800 simple interest rate: 2.5% time: 20 years Do viruses have no nucleus? If f(x) = log (x/4) and g(x) = 2 log x, find (g f) (x). What is sets in real life? What are the rules of classification of data? Why was the sinking of the Lusitania so controversial?