What is the meaning of coherent thought?

Answers

Answer 1

The meaning of coherent is having clarity or intelligibility; understandable.

If a person is coherent, they explicit their mind in a clean and calm way, in order that different humans can recognize what they may be saying. If a person speaks coherently, they may be talking in reality and lucidly. A mild variant at the that means comes withinside the feel of some thing this is united in reality as an entire and a recognizable entity. You may say, for example, that New York City is a "culturally coherent region" in the United States. If a paragraph is coherent, every sentence flows easily into the subsequent with out apparent shifts or jumps. A coherent paragraph additionally highlights the binds among antique and new records to make the shape of thoughts or arguments clean to the reader.

To learn more about paragraph check the link below:

https://brainly.com/question/27073860

#SPJ4


Related Questions

What happens at the end of the story Owl Creek Bridge?

Answers

Bierce explains that Peyton Farquhar had dreamed the entirety of his escape and that, in reality, he was "dead; his body, with a broken neck, swung gently from side to side beneath the timbers of the Owl Creek bridge."

What happened at Owl Creek Bridge?

The true Owl Creek Bridge is in Tennessee; Bierce, who personally participated in three military executions during his time in the military, probably altered the setting to northern Alabama because the real bridge did not have a railroad close by at the time the narrative is set.

Farquhar arrives at his front gate by dusk. He recognizes his wife, but as he prepares to embrace her, he feels a strong blow on the back of his neck. Bright white light fades to total darkness. Farquhar's body hangs below Owl Creek Bridge with a broken neck and he is dead.

Bierce reveals in the conclusion of "An Occurrence at Owl Creek Bridge" that Peyton Farquhar had dreamt the entirety of his escape and that, in reality, he was "dead; his body, with a broken neck, swung gently from side to side beneath the timbers of the Owl Creek bridge."

To learn more about Owl Creek Bridge refer to:

https://brainly.com/question/1995317

#SPJ4

Is revenge justified in Hamlet essay?

Answers

Yes, the revenge is justified in Hamlet essay written by Shakespeare.

The fear is a justification for revenge therein failing to try and do thus can bring tragedy to Hamlet's life. the requirement to stick to his father's ghost justifies the revenge mission that Hamlet undertakes within the play. The ghost commands Hamlet to revenge his father's “foul and most unnatural murder”

Shakespeare's message concerning revenge in Hamlet could be a complicated one. In Hamlet's case, he felt he had an ethical obligation to retaliate his father's death. However, as playwright demonstrates, the trail of retaliation could be a untidy one with harmful repercussions and sometimes takes several innocent lives within the method.

To learn more about Hamlet here

brainly.com/question/3386851

#SPJ4

How might Rikki's character and actions help the reader determine the theme? (USE THE R.A.C.E METHOD FOR YOUR ANSWER)

Answers

"Rikki-Tikki-Tavi" is a short story set in India during the colonial era. The story is told in the third person through a narrator. In this story, a family with a small child named Teddy adopts a mongoose and names him Rikki-Tikki-Tavi. Rikki loves the family for saving his life after a monsoon washed him from his family burrow. He protects the family and garden animals from the cobras, Nag and Nagaina, who threaten the garden animals and want to kill Teddy and his family so they can take over the bungalow. Rikki battles the cobras and wins, saving the family and the garden.

Rikki and Nag

The story was written by Rudyard Kipling. Although a renowned writer, Kipling had very colonialist and racist viewpoints, which occasionally made their way into his stories. Rikki-Tikki-Tavi is unfortunately one of those tales.

"Rikki-Tikki-Tavi" Characters

The main characters of "Rikki-Tikki-Tavi" are:

Rikki-Tikki-Tavi: The protagonist of the story. A protagonist is usually the main character or hero of a story and is responsible for driving the plot forward. Rikki is a small, brave mongoose who lives with Teddy's family and protects the garden wildlife, Teddy, and Teddy's family. As the protagonist, Rikki personifies bravery, confidence, and loyalty. He is brave and full of confidence when he battles the cobra's Nag and Nagaina. He is loyal to Darzee, Darzee's wife, and his human family, and he stands up to Nag and Nagaina.

Nag and Nagaina: The male and female cobras who rule the garden of the family's home are the antagonists of this hero's journey-styled plot. Antagonists are often the villains of a story and usually represent an obstacle that the protagonist must overcome and defeat to reach a goal. Nag and Nagaina have different reactions when the story reaches the climax and Nagaina faces losing her eggs. She pleads with Rikki to spare her children, which shows her softer side. Ultimately, Rikki outwits and defeats the villains.

Teddy: The young British boy who saves Rikki-Tikki-Tavi and befriends him. When Teddy is attacked by the cobras, Rikki-Tikki-Tavi saves him, just as Teddy once saved Rikki. The young boy is innocent and appeals to the reader's memory of the purity and safety of childhood.

Teddy's mother: Alice is a sweet, kind, empathetic woman.

Teddy's father: He is a British soldier and a protective father. He acknowledges Rikki's bravery in saving Teddy, Alice, and him from the cobra Nag. Nagaina believes Teddy's father killed Nag and seeks vengeance by attacking Teddy.

Chuchundra: The muskrat in the garden who is afraid of the cobras and wants to avoid confrontation.

Karait: A snake in the garden (and antagonist) who tries to bite Teddy early in the story. Rikki kills Karait to protect Teddy.

Darzee: A tailorbird who lives in the garden with his wife and family. He is afraid of Nag and Nagaina, so he rarely leaves his nest. He is a silly character who sings and provides commentary but offers little help against the threat of the cobras.

Darzee's wife: She is an active character who is angry at Nag for eating one of her babies. She helps Rikki win the battle against the cobras by pretending to be wounded and providing a distraction.

What are irregular lines?

Answers

A phrase used to describe works of art that highlight the use of primarily straight lines and forms yet are created without the use of a straightedge. These lines frequently show the hand motion of the artist who drew them, and as a result, they may look blurry, uneven, or flawed, as in the works of Paul Klee or Mark Rothko.

Who are artists?

A person involved in the creation, practise, or demonstration of an art is said to be an artist. The typical use in academic discourse and daily speech solely refers to a visual arts practitioner. Although it is also frequently used in the entertainment industry, particularly in a professional setting, for musicians and other performers (although less often for actors). The English equivalent of the French word for artist, "artiste," is occasionally used in this context. Although it is acceptable, the term "artist" is rarely used to describe authors and is often only applied in critical circumstances.

Technical expertise is implied by the Greek term "techn," which is sometimes translated as "art." The Latin adjectival term "technicus" served as the basis for the English words technique, technology, and technical.

To learn more about artists from the given link

https://brainly.com/question/25729154#SPJ4

#SPJ4

What are irregular lines?

How many types of verbal irony are there?

Answers

There are four sorts of linguistic irony in this basic definition: Sarcasm. Understatement. Overstatement.

Overstatement, exaggeration, and hyperbole are all examples of linguistic irony that accentuate the significance of what is being given.

Sarcasm (saying "Oh, terrific!" when the situation is truly terribly awful) Socratic irony (pretending to be uninformed in order to demonstrate that someone else is ignorant: "I'm perplexed, I thought your curfew was at 11 p.m...." understatement (stating "We don't get along" after a major argument with someone)

The three most popular types in literature classes are verbal irony, dramatic irony, and situational irony. Here are some well-known examples: "But Brutus claims he was ambitious; / And Brutus is an honourable guy." Shakespeare's Julius Caesar.

Learn more about to irony visit here;

https://brainly.com/question/1695719

#SPJ4

Why is parallel structure used?

Answers

Parallel structure, or parallelism, means using the same pattern of words to show that two or more words or ideas are of equal importance. Words and phrases within a sentence should not only match in structure, but also in tense.

Writers use parallel structure to add clarity to their writing, make it easier to understand and show that their writing is structurally and grammatically correct. Explore parallel structure examples to better understand the concept.In medias res is the plot device.

That enables authors to "come late" to their own story. It is a Latin expression that essentially means "in the thick of things." Sometimes writers prefer to start their novels in the middle rather than bothering to give their characters a past. An illustration would be Neil Gaiman's "American Gods," as we don't learn about each god's history right away.

To know more about parallel structure visit:

https://brainly.com/question/1674651

#SPJ4

Who is Swift attacking in A Modest Proposal?

Answers

In "A Modest Proposal," Swift criticizes a variety of targets, including the powerless Englishmen (landlords, legislators) who are unconcerned with the Irish problem, the uninterested and unmoved readers.

In A Modest Proposal, who is Swift making fun of?

Swift suggests that the starving Irish people sell their extra children to the wealthy as food in this explosive, satirical article. Swift adopts an exaggeratedly callous tone that mocks individuals who have Unfavourable views about the Irish poor, including the Irish rich, politicians, and British officials.

The essay, which is disguised as an economic dissertation, suggests that Ireland's underprivileged children should be butchered and sold to affluent English landowners as food in order to reduce poverty there. Swift's plan is a scathing critique of England's exploitation of Ireland on a legal and economic level.

To know more about Swift criticizes visit:

https://brainly.com/question/29552927

#SPJ4

What is Elizabethan style of writing?

Answers

The Elizabethan style of writing is  new forms like the sonnet, Spenserian stanza, and dramatic blank verse, as well as prose.

what is Elizabethan style of writing?

It was distinguished by a strong sense of patriotism, national pride, religious tolerance, social content, academic advancement, and boundless excitement. The drama gives voice to such a time of intense emotion, thought, and action, and its amazing progression culminates inThe fluidity, sweetness, melody, and exuberant joy in life all of which are direct, spontaneous, and exquisite are the characteristics that particularly set Elizabethan poetry, especially lyrics apart.Dramatic literature flourished during the Elizabethan era. Blank verse was one of the most widely used forms for dramatic plays during this time. Unrhymed blank poetry is typically composed in iambic pentameter. Its metrical structure most closely approaches that of human speech.

To learn more about Elizabethan style of writing refers to;

https://brainly.com/question/28396171

#SPJ4

What are the 4 characteristics of a sonnet?

Answers

The characteristics of a sonnet are structure, rhyme, theme, and tone.

A sonnet is typically composed of one 14-line stanza. The lines are written in iambic pentameter, which has a rhythm of an unstressed syllable followed by a stressed syllable in each of the ten syllables of each line. Themes like love, nature, time, and mortality are frequently explored in sonnets.

The majority of sonnets use one of two common rhyme schemes. The Italian sonnet has an octave, the first eight lines that pose a problem or question, and a sestet, the final six lines that provide a resolution or answer, or the English or the Shakespearean sonnet, which uses the rhyme scheme abab cdcd efef gg. A sonnet's tone might vary, but it is frequently intimate and contemplative, expressing the speaker's sentiments about the poem's content.

Read more about sonnet on:

https://brainly.com/question/1334542

#SPJ4

Is Huck Finn realism or Naturalism?

Answers

The Adventures of Huckleberry Finn by Mark Twain is an illustration of the regionalist style of realism.

Because it was written in the vernacular style, rather than employing literary language, it attempted to mimic peoples' speech patterns. In his novel The Adventures of Huckleberry Finn, one of the most well-known American authors of the nineteenth century, Mark Twain, uses realism to depict the late nineteenth-century themes of race, identity, and social standing. As a result, The Adventures of Huckleberry Finn by Mark Twain is regarded as a work of realism, a literary genre that aimed to present life without the frills and dreams shown in romanticism. The story's setting right before the American Civil War is a crucial component as well.

To learn more about language click here https://brainly.com/question/2714657

#SPJ4

Based on the author's word choices in paragraph 1, which word best describes the author’s tone?

(A) critical
(B) optimistic
(C) annoyed
(D) neutral

Read the passage.

The Great Pacific Garbage Patch

There’s been talk that there is a giant pile of trash floating out in the middle of the Pacific Ocean. According to some reports, the Great Pacific Garbage Patch is supposedly twice the size of the state of Texas. This has led many people to envision a humongous pile, both in height and breadth. However, this is a gross exaggeration. True, there is trash floating around in the Pacific, but it’s quite different from what has been portrayed in the media. Nonetheless, there is still cause for concern.

In an area of the northern Pacific Ocean where the northern jet stream and the southern trade winds create a high-pressure zone, the winds circulate in opposite directions. These winds create an area of 7.7 million square miles of circling water called the North Pacific Gyre, which covers most of the northern Pacific Ocean. In the middle of the gyre are pieces of plastic garbage. This garbage isn’t a huge pile of floating pieces of trash, peoples tossed-away coolers, broken pieces of furniture, or boat seat cushions. It’s more insidious than that.

Answers

Answer: (D) neutral

Explanation:


The author's tone in paragraph 1 is neutral because they are simply presenting information about the Great Pacific Garbage Patch without expressing any personal opinion or emotion. The author is not critical, optimistic, or annoyed, but simply stating facts and providing information.

Answer:

D.) Neutral

Explanation:

I say neutral because in the 1st paragraph the author was stating a fact and was saying that the garbage was really big and that it was twice the size of the state of Texas but when you keep reading he/she says that this is just an exaggeration. He wasn't being critical, optimistic or annoyed he/she was neutral, she/he wasn't really bothered by it.

What is the ratio of homozygous yellow with wrinkled seeds and homozygous round with green seeds in f2 of classical dihybrid cross is?

Answers

A dihybrid cross consists of two individuals with two distinct traits controlled by two distinct genes. The idea of a dihybrid cross was developed as a result of Gregor Mendel's study of pea plants that were either round or wrinkled, yellow or green.

What classical dihybrid cross is?

A dihybrid cross consists of two individuals who are heterozygous for two different traits. The individuals who display this feature are homozygous for it.

Therefore, 3:1:9:3. Is the ratio of homozygous yellow with wrinkled seeds and homozygous round with green seeds in f2.

Learn more about dihybrid cross here:

https://brainly.com/question/1185199

#SPJ4

A 3. What does lyric poem
lack or not have that is useful for finding the theme?
a title
complete sentences
a setting
plot

Answers

A Setting.

Modern lyric poetry is a formal genre of poetry that speaks of one's own sentiments or emotions, usually in the first person.

Modern lyric poetry is a formal kind of poetry that often uses the first person to communicate personal emotions or feelings. The misconception comes from the fact that it is not the same as song lyrics, despite the fact that song lyrics are frequently in the lyric form, nor is it the same as Ancient Greek lyric poetry, which was primarily limited to song lyrics or chanted verse.

The term "lyric" is derived from a type of Ancient Greek literature called the "Greek lyric," which was characterized by its accompanying music, typically on a stringed instrument called a kithara[a]. Both modern lyric poetry and current song lyrics use this term. The distinction between the three major categories of poetry—lyrical, dramatic, and epic—developed by Aristotle is what gives the term its significance in literary theory. One of earliest genres of writing is lyric poetry.

To know more about lyric poem, click on the link below:

https://brainly.com/question/2017971

#SPJ1

What is Mark Twain's message in The Adventures of Huckleberry Finn?

Answers

The Adventures of Huckleberry Finn is a novel by American author Mark Twain set in the pre-Civil War South that exposes institutionalized racism and tackles themes of freedom, civilization, and prejudice.

Huckleberry Finn explores the notion of liberty and the price, if any, at which a person is genuinely free in two basic views of freedom. Huck and Jim both want independence, but they have quite different notions about what that entails. This disparity is due, in part, to what each character believes he is gaining freedom from. Huck, for example, longs to be free of "civilized" society. Heavy clothing, formal schooling, and, of course, home life suffocate him: "Living in a house, and sleeping on a bed, tugged on me quite tight, basically."

To know more about Mark Twain:

https://brainly.com/question/12474660

#SPJ4

What is Frederick Douglass speech what the black man wants about?

Answers

Frederick Douglass calls for Black Americans to have the right to vote and civic equality in a speech from 1865. Frederick Douglass advocated for government action to guarantee that Black Americans have access to land, voting rights, and civic equality.

What is the definition of "voting rights"?

Voting rights are a group of statutory and constitutional protections designed to guarantee that most adults have the opportunity to cast ballots in local, state, and federal elections.

Is it my responsibility or right to vote?

No one in the United States is required by law to vote in any local, state, or federal election. There have been numerous ratified constitutional amendments since the first election.

To know more about the voting rights visit :-

https://brainly.com/question/6826755

#SPJ4

Why does Katniss think Peeta Wouldnʼt understand about owing someone or paying back your debt )?

Answers

Katniss believes that since he is not from the Seam and has never had to battle to survive, only those who have experienced such challenges are aware of "paybacks."

How is Katniss in Peeta's debt again?

Because Katniss attempts to speak to the Avox at dinner, when doing so is prohibited, she has once again incurred Peeta's wrath.

What does Katniss realize about Peeta?

Katniss understands that Peeta actually likes her and isn't simply being fl*rtatious. Peeta first developed feelings for Katniss when she was five years old after her mother was mentioned by Peeta's father.

What are three reasons Katniss is suspicious of Peeta?

She believes that he may be behaving out of kindness at times, which is more perilous for her because she is aware that she won't be able to kill a kind Peeta Mellark. She is occasionally persuaded that he is plotting, misleading her and others. The dandelion picture reappears.

To know more about Katniss and Peeta visit:

https://brainly.com/question/16048651

#SPJ4

How do you write a compare and contrast essay examples?

Answers

Selecting two or more themes that are tangibly related is the key to creating an effective comparison and contrast essay. Instead of stating the obvious, comparison and contrast are used to draw attention to subtle differences or unexpected similarities.

The topic sentence that comes first should include one aspect of the comparison between your first and second subjects. You might start by giving a general summary of the political institutions in each country if your paragraph's theme is state apparatus and your topics are two different countries.

A compare and contrast essay could

start with an introduction that gives background information and a thesis that states what you're comparing and why.a section in the body comparing and contrasting the two subjectsa section in the body comparing and contrasting the two topics

To know more about compare and contrast essay, click on the link below:

https://brainly.com/question/13817103

#SPJ4

I want your help!
Can you do 3-5 min essay about The importance of Technology and its effects on the present and Future

Answers

Yes, a sample essay on the Importance of Technology and Its Effects on the future is given below. Note that this is an explanatory essay.

What is the sample essay given above?

Technology has become increasingly important in our daily lives, shaping the way we work, communicate, and access information. It has revolutionized many industries and has had a significant impact on the present and future.

One of the most significant implications of technology in the present is how it has changed the way we do business. Companies may now employ technology to improve efficiency and production by streamlining their processes. Furthermore, technological advancements have made it simpler for people to work remotely, providing for more flexible work arrangements.

Thinking forwards, technology is expected to continue to play a significant role in influencing civilization. It has the ability to disrupt sectors and open up new avenues for growth and development.

Learn more about explanatory essays:
https://brainly.com/question/14711260
#SPJ1

Ralph Waldo Emerson was influenced by European writers, including:

Answers

Answer:

Ralph Waldo Emerson was influenced by a number of European writers, including the English poets William Wordsworth and Samuel Taylor Coleridge, as well as the German philosopher Immanuel Kant. Emerson's ideas about individualism and self-reliance were also influenced by the French philosopher Jean-Jacques Rousseau. Additionally, Emerson was influenced by the works of the Scottish philosopher and economist Adam Smith, particularly his book "The Wealth of Nations." These writers and philosophers had a significant impact on Emerson's thought and writing, and their ideas can be seen throughout his works.

What are the 4 types of conditioning?

Answers

There four types of  conditioning techniques included that Positive reinforcers, Negative reinforcers, Positive punishers and Negative punishers. Also there are two important concepts of conditioning are Classical and operant which is centrally focused to behavioral psychology.

Positive reinforcers means to the addition of a reward. Negative reinforcers means to the removal of a punishment. Positive punishers means to addition of a punishment. Negative punishers means to removal of a reward.

Both operant and classical result in learning and both suggested that a subject can adapted according their environment.the most effective type of conditioning is Delay conditioning.

Learn more about Positive reinforcers click on the link here:

https://brainly.com/question/14299460

#SPJ4

7. If a writer looks back at their text and hates everything they wrote, their hatred is MOST likely stemming from what root cause?

Answers

Answer:An number of things

Explanation:

Insercurity, self loathing and self doubt.

What are the 5 ASL parameters?

Answers

Answer:

handshape, palm orientation, movement, location, and expression/non-manual signals.

Explanation:

In American Sign Language (ASL), we use the 5 Parameters of ASL to describe how a sign behaves within the signer's space. The parameters are handshape, palm orientation, movement, location, and expression/non-manual signals.

What is Adam Smith's main idea quizlet?

Answers

Adam Smith's main idea was regarding  the importance of free markets

Who was Adam Smith?

Adam Smith was born in 1723 and died in 1790. He was a moral philosopher and economist, usually regarded as the father of modern economics. Smith's work is both a pillar of contemporary philosophy and a key source of political and economic transformation throughout the last two centuries.

Adam Smith was one of the first thinkers of his day to assert that money is generated via productive effort and that self-interest encourages individuals to maximize the use of their resources. He said that profits derived from capital investments, and that money is directed to where it can make the most profit.

Therefore, Smith's ideas are the necessity of free markets, assembly-line manufacturing processes, and GDP which is formed the foundation for classical economic theory.

Learn more about Adam Smith here:

brainly.com/question/21764310

#SPJ4

What are some other words for storage?

Answers

Answer: Depository

Explanation: Depository is a synonym for storage.

What is your perception about reflexive and intensive pronoun?

Answers

A reflexive pronoun relates back to the sentence's subject, whereas an intensive pronoun emphasizes or amplifies a noun.

I, you, him, her, it, ourselves, yourself, and themselves are examples of the intensive/reflexive pronouns. An intense pronoun is one that emphasizes its antecedent and ends in "self" or "selves." Reflexive pronouns can be used to emphasize that someone performs it personally and not on behalf of anyone else. Reflexive pronouns are used when the same person is the subject and object. To stress the subject that person or thing and nobody else intensive pronouns are utilized. Similar to intense is intense. Something powerful is intense. A pronoun's reflexive/emphatic/intensive case is used to denote an activity that has an effect on the performer.

To learn more about intensive pronouns click here https://brainly.com/question/18269698

#SPJ4

What was the conflict problem in the story?

Answers

Conflicts determines how the storyline develops, making it the driving force behind every story. There is no plot arc and no character development without conflict.

What is conflict in a story?Conflict is a fight between competing forces in a narrative. Conflict begins when characters take action to oppose those forces. There is no story if there is nothing to overcome. The storyline of a novel is created and advanced by conflict.The challenges a character encounters in the outside world are referred to as external conflict. The psychological or emotional struggles of a character are referred to as internal conflict. The worldview or belief system of a character clashes morally or philosophically with the outside reality.It's important to keep in mind that dividing conflict into external and internal components is overly simplistic. The proper definition of conflict in a story also considers how it relates to moral or philosophical conflict.Why is conflicts important in stories?It instigates and propels the story.It entertains by providing realistic circumstances in emotional, risky, or thrilling ways. It shows contrasting opinions and realities about life.

Conflict definition.

Mental conflict brought on by conflicting or incompatible wants, desires, wishes, or demands from within or without His duty and conscience were at odds. The conflict between individuals or forces that results in the dramatic action in a play or a work of fiction

Conflict situation definition. A conflict situation is one in which a director has, or is potentially in a position to have, a direct or indirect interest that is at odds with the interests of the firm (including a conflict of interest)

To know more about conflict in a story refer to :

https://brainly.com/question/28986495

#SPJ4

What are the main conflicts in the story and how are they resolved Of Mice and Men?

Answers

The main conflicts in the story Of Mice and Men is George and Lennie's desire to one day possess their own farm serves as the primary source of conflict. Their main objective is to make enough money to become financially independent guys who are not dependent on others for job.

The battle for survival that George and Lennie engage in is the primary conflict in Of Mice and Men. They move throughout places searching for employment as migrant laborers to sustain themselves, but this is made challenging since Lennie keeps getting them into problems. Through their own concerns about their own social and financial standings, the other characters mirror this battle to achieve stability.

After repeating their common goal of owning a farm one more time, George shoots Lennie in the back of the head to protect him from Carley's anger at the conclusion of Of Mice and Men.

For more such question on Mice and Men.

https://brainly.com/question/19164862

#SPJ4

How can I improve my daily decision making?

Answers

I can improve my daily decision making by collecting the information about the particular situation.

Some of the ways which can helps me to improve my decision making are:

1. Make an arrangement

In the event that you realize you have a forthcoming choice to make, it can assist with making an arrangement.

2. Be decisive

Have a go at assuming control over the dynamic interaction. You could have a go at prompting a gathering on every decision's upsides and downsides and drawing courses of events for guarantee a speedy and useful choice.

3. Ask a specialist

Hearing one more point of view can assist with approving your choices and give you additional trust in your critical thinking skills. You could take a stab at asking a neighborhood master, or you can continuously ask a confided in companion.

4. Keep it in context

Take a stab at passing judgment on the worth of every choice. Rather than investing broad energy discussing more modest choices, for example, the textual style type for your organization writing, center around bigger choices.

5. Set cutoff times

Set time impediments for yourself on every choice you make. This can assist with limiting how long you need to alter your perspective or ponder choosing. You initially could have to find the significance of your choice.

To know more about decision making, visit here:

brainly.com/question/16407152

#SPJ4

How does Agile deal with compliance requirements?

Answers

Adopt a hybrid strategy,Adopt a full delivery life cycle,Focus on solutions, not just software,Take a goal-driven approach,Be enterprise aware like this Agile deal with compliance.

Scrum, ITIL, Agile Modeling, Kanban, Unified Process, COBIT, and many more methodologies are all included into the hybrid approach known as DA. Regulations frequently address a wide variety of topics, so you must adopt supplemental practises from several sources. Most laws include not only construction but the whole delivery lifespan. Value streams have their own life cycle, which DA supports. Agile teams with disciplined work products that can be consumed rather than merely "shippable software." This approach directs teams as they make process decisions, some of which will be influenced by regulatory compliance. Enterprise awareness, or the understanding that agile teams don't operate in a vacuum, is one of the DA Mindset's guiding principles.

learn more about principles Refer:brainly.com/question/7413269

#SPJ4

Why does Beowulf not kill Grendel's mother?

Answers

Beowulf uses the magical sword to slay Grendel's mother in a cave after a challenging duel between the two of them.

Beowulf meets Grendel's mother in a cave. He strikes her with Unferth's Hrunting, his sword, but it cannot break her skin. He then drops the sword and uses only his fists to start beating the mother. "In his might, his tremendous hand-grip," he puts his trust. Grendel's mother is successfully knocked to the ground by Beowulf, but she promptly rises to her feet and sits on top of him. She tries to kill him with a knife, but Beowulf's armor protects him this time. After successfully removing her from himself, Beowulf notices and seizes a large sword.

At the end, Beowulf kills Grendel's mother.

To know more about Beowulf poem, visit,

brainly.com/question/1830314

#SPJ4

Other Questions
How do religious and ethnic groups both reflect and influence the geography of places at differentscales? You must use a number line!n + 5 > 13PLZ HELP ILL PUT BRAINLIEST What is the measure of arc QSR? Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Find the verbal in the sentence below. Then, Identify the type of verbal.Jane wanted to forget about the matter.-infinitive-participle-gerund Which choice is similar to the figure shown?Please help Im confused on what to do. A physics student of mass 43.0 kg is standing at the edge of the flat roof of a building, 12.0 m above the sidewalk. An unfriendly dog is running across the roof toward her. Next to her is a large wheel mounted on a horizontal axle at its center. The wheel, used to lift objects from the ground to the roof, has a light crank attached to it and a light rope wrapped around it; the free end of the rope hangs over the edge of the roof. The student radius 0.300 m and a moment of inertia of 9.60 kg m^2 for rotation about the axle, how long does it take her to reach the side walk, and how fast will she be moving just beofre she lands? a wave travels one complete cycle in20sec and has wavelength of 1000mm.what is the speed Solve for y:5y+2-2y=8y-4-2y Voluntary migration on culture PLEASE PLEASE HELP IVE BEEN STUCK ON THIS FOR TOO LONG help me please this gives 30 points Describe the steps a plant would take to move sugars from a source to a sink. Which of the following is a check on the power of the judicial branch? aThe president overturns a Supreme Court ruling. bThe House of Representatives impeaches a justice. cThe Senate nominates judges for the Supreme Court. dThe Congress rejects a ruling by the Supreme Court.