Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
4. Which phrase best describes cancer?
a. absence of cyclins
b. multiple gene mutations
c. uncontrolled cell growth
d. presence of genetic defects
Answer:
B: Multiple gene mutations
Explanation:
Mutations can be very small changes, affecting only a few nucleotides or they can be very large, leading to major changes in the structure of chromosomes. Both small and large mutations can affect the behavior of cells. Combinations of mutations in important genes can lead to the development of cancer.
Uncontrolled cell growth phrase best describes the Cancer. So, the correct option is (C).
What is Cancer?
Cancer is a disease which caused when the cells divide uncontrollably and it is spread into surrounding tissues. Cells which are divided uncontrollably they are abnormal in nature and also spread to different parts of the body. These cells may form in the lumps of tissues known as Tumors. They are of two types - Cancerous and Non-Cancerous (benign).
Cancerous tumors spread to the nearby tissues or invade into it. It can travel to different places in the body to form new tumor which is called metastasis. Cancerous tumors are also called malignant tumors. Mots of the cancers occur from the solid tumor but in case of blood cancer, it is not.
It is mainly caused by the alteration of DNA. Genetic changes that cause cancer can occur because
Some errors which occur when the cells divide. Damage to DNA which caused by harmful substances in the environment, such as the chemicals in tobacco, smoke, etc.It can be inherited from the parents.Thus, uncontrolled cell growth phrase best describes the Cancer. So, the correct option is (C).
Learn more about Cancer, here:
https://brainly.com/question/8590464
#SPJ2
An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.
Answer:
An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.
Explanation:
The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.
What is tsunami?The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.
These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.
Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.
When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.
Thus, the correct option is C.
For more details regarding tsunami, visit:
https://brainly.com/question/14782736
#SPJ6
1. People with diabetes tend to suffer from extreme thirst and frequent urination. These symptoms are signs that the body is not in homeostasis . How the body trying to regulate its blood sugar levels ?
Answer:
The bloodstream carries glucose a type of sugar produced from the digestion of carbohydrates and other foods-to provide energy to cells throughout the body
Explanation:
What is the definition of cell
Answer:
Small and sparsely furnished room, especially in a prison or convent.
"the detainees are together in cells with capacity for four or five people"
Cell of a honeycomb.
Explanation:
I hope to help you
Someone help meeeee with both of these pleaseeeee
Answer:
for the first one the first, second and last one seem most likely
for the second question the answer is the third one
Explanation:
Female cones contain _____, which contain the eggs
Answer:
I'm going to answer before some butthead says "ovule" IT IS NOT OVULE
Explanation:
its not ovule or sperm, its "seeds"
how is starch formed (like the detailed explanation) and how is it digested by the animal
Answer:
In the monogastric diet, starch is the primary carbohydrate. In the small intestine, starch is digested by pancreatic amylase in conjunction with other enzymes. The complex polysaccharides are completely digested to monosaccharides. The monosaccharides are readily absorbed into the bloodstream via the small intestine.
Explanation:
Answer:
what exaclty zackary warren said
Explanation:
he is correct :)
Phenotypes are the
observable characteristics of an individual (ex:
curly hair)
or
genetic representation of a an individual (ex: Hh)
Answer:
phenotype are the observable characteristics of an individual (ex:curly hair)
If a 50kg car is pulling a 30kg car, how much force would be required to accelerate the cars at 2m/s/s?
Answer:
the force needed to accelerate the 1000kg car by 3m/s2 is 3000N .
The carbon cycle is based on CO2. Therefore, photosynthesis is the opposite of
A
cellular respiration.
B
reproductive cycle.
C
nitrogen cycle.
D
biochemical processes.
Answer:
A Cellular Respiration
Explanation:
This is because Photosynthesis takes CO2 and pushes our Oxygen, while the inverse is true for cellular respiration.
please help i need help please
Help please ASAP I’m times
When the concentrations of solutions are the same on both sides of a membrane, the two solutions are
Answer:
di ko nga alam sagot dyan ii search mo nalang sa ibang application bhie
Which scenario shows a division of labor?
O A. In the lunchroom line in the school cafeteria, two workers serve the food to all the students.
O B. On an assembly line at a car factory, some workers attach windows todays while others paint the cars.
O C. At the toll stops on a major road, one worker collects money in one toll booth while another worker collects money in a different toll booth.
O D. At the museum, there are always several people available to provide guided tours for people who are interested in learning more about the museum's collections.
Answer:
B. On an assembly line at a car factory, some workers attach windows to while others paint the cars.
Explanation:
TRUE or FALSE?
When reading the codon chart, you are supposed to use the tRNA anticodon to find the amino acid.
Cyanobacteria have been aorund for 3.5 billion years or more. They can live in aggregations of cells called mats. When did cells of cyanobacteria first start showing evidence of differentiation (i.e. cells becoming different in form and function)?
A.
0.5 billion
B.
1 billion
C.
2 billion
D.
3 billion
E.
When Muhammed Ali beat Sonny Liston in 1965 to become heavyweight boxing champion of the world
Answer:
The correct answer is - option C. 2 billion.
Explanation:
Cyanobacteria or BGA are microscopic organisms that live in water bodies normally and make their own food. These are unicellular organisms that have been around 3 and a half million years and consider as the first photosynthetic organisms responsible for the availability of oxygen on earth. These cells are also considered as the cell that evolved in the eukaryotic cells by differentiation around 2 billion years ago. The aggregated form of the cells are known as the mats.
DNA evidence analysis is an imperfect science. Provide two reasons why this may be the case.
For my Biomedical Science Class
Answer:
Not all DNA that was found at the scene has to be related to the scene.
Explanation:
Just because DNA was found at the scene, that doesn't mean that the person there is actually guilty. For example, in a case where person B is guilty, a strand of hair from Person A could be carried over to another scene on Persons B's clothing.
Answer:
Because DNA is more reliable than other forensics, scientists have shrugged off suggestions that it could fall victim to the vagaries of bias. But Dror noted that much DNA analysis involves interpretation. With interpretation comes subjectivity, and with subjectivity can come error. Only one-tenth of 1 percent of human DNA differs from one individual to the next and, although estimates vary, studies suggest that forensic DNA analysis is roughly 95 percent accurate.
Explanation: Hope this helps
what does balance diet consist of?
please help!!
Answer:
Fruits, vegetables, lean meat, limiting saturated fats, eating controlled portions.
Explanation:
Fruits and vegetables are extremely important for a balanced diet. Same with lean meat.
These provide good amounts of fiber and protein.
Eating less saturated fats are good too. Same with eating controlled portions so you do not over or under eat.
Hope this is correct, good luck with your studies.
Answer:
A balanced diet contains foods from the following groups: fruits, vegetables, dairy, grains, and protein.
what is the benefit of the pigments in photosynthesis
Answer:
Because they interact with light to absorb only certain wavelengths, pigments are useful to plants and other autotrophs --organisms which make their own food using photosynthesis. In plants, algae, and cyanobacteria, pigments are the means by which the energy of sunlight is captured for photosynthesis.
Explanation:
Answer:
energy
Explanation:
Because they interact with light to absorb only certain wavelengths, pigments are useful to plants and other autotrophs --organisms which make their own food using photosynthesis. In plants, algae, and cyanobacteria, pigments are the means by which the energy of sunlight is captured for photosynthesis.
cancer occurs when signals for ______ are blocked or misinterpreted
Answer:
death of cells
Please answer quickly!! Timed test! Which term is correctly paired with its role in the body? A) Insulin – a sugar that regulates blood glycogen levels B) ADP – a molecule that releases energy when it forms ATP C) Glycogen – a hormone found in blood that regulates blood glucose levels D) Glucose – a sugar found in blood that can be broken down to produce ATP
Answer:
The correct answer is - D) Glucose – a sugar found in blood that can be broken down to produce ATP
Explanation:
Insulin is a hormone produced by the beta cells of pancrease that takes up the glucose from the bloodstram and make gucose available to the cells of the body to produce energy by the process of cellular respiartion. Glucose is breaken down to its smaller units and produced high amount of energy in the form of ATP. Glycogen is form of sugar that is stores in the muscle and othe cell for the energy in abscence or low glucose level in blood stream. ADP is a molecule know as adesnosine pyrophosphate or diphosphate which is play role in flow of energy. ADP molecules requires energy to form ATP molecule and when ATP splits into ADP and Pi releases high amount of energy.
Answer:
D glucose – a sugar found in blood that can be broken down to produce ATP
Explanation:
I took it on eng
Eukaryotic cells are somatic non-sex cells true or false
Answer:false
Explanation:somatic and non-sex is the same thing. Although Eukarytic cells can be sex cells, there are also some that are non-sex cells.
now write the mRNA strand for the given DNA strand
Answer:
UACAGCGACUAUGACA
Explanation:
mRNA and DNA have the same nucleotides, except mRNA has U (Uracil). U bonds with A (Adenine).
Hope that helps.
Which of the following is NOT a function of a protein?
A)store and carry out the genetic code
B)building materials
C)control the rate of reactions and regulate cell processes (enzymes)
D)transport things in an out of cells (cell transport)
The storage + the transmission of genetic info are NOT done by proteins but by your DNA.
A would be your answer.
The atmospheric ozone layer which protects us from UV rays is
getting depleted, mostly by the addition of
a Carbon dioxide
b Chlorofluorocarbons
C Sulfur
d All of the above
I’m not sure what the answer is
Answer:THe answer would most likely be D
Explanation:
because carbon dioxide many know that is one of the main reasons behind the global warming epidemic and sulfur is a gas that can trap heat chlorofluorocarbons does exactly what carbon dioxide does. therefor your answer would be answer D.
Compare and Contrast: Where is the electron transport chain found in a eukaryotic cell? Where is it found in a prokaryotic cell?
Answer:
Mitochondria for eukaryotic cell. Cytoplasmic membrane for prokaryotic cell
Explanation:
What type of microscope would be best for studying the movement of the digestive and circulatory systems of Daphnia magna? __
Answer:
Light
Explanation:
I just took the test and got it right.
We are required to find the type of microscope would be best for studying the movement of the digestive and circulatory systems of Daphnia magna
The type of microscope which would be best for studying the movement of the digestive and circulatory systems of Daphnia magna is Electron microscope.
Daphnia magna is a small planktonic crustacean with a size of about 1.5mm - 5mm that belongs to the subclass Phyllopoda.Microscope is laboratory instrument use to examine objects that are too small to be seen with the naked eyes.The best type of microscope that can be used to study the movement of the digestive and circulatory system ofDaphnia magna is an
Electron microscope.
Read more:
https://brainly.com/question/13454187
Which organ anchors a plant to the soil?
A. Stem
O B. Root
O C. Leaf
O D. Flower
SUBMIT
Act
PREVIOUS
Answer:
B. Root is the correct answer
Answer:
Roots
Explanation:
Corals grow in dense groups on the floor of the ocean. Which type of distribution pattern does this represent, and what is the advantage of this distriubtion?
Answer:
Clumped distribution
Explanation:
Clumped distribution is a type of distribution in which organisms are clustered in groups. This is the most common form of distribution. Clumped distribution occurs in environment that are patchy (the patches are the part suitable for the organism to live in).
Clumped distribution is good because organisms have better protection from predators providing defense, and there is more access to food resources.
Since the Corals grow in groups on the ocean floor, hence it is a form of Clumped dispersions.
One farmer plans to grow soybean. Soybeans grow best in medium loam soil. Which of these is the most likely soil sample that the farmer would select to grow soybeans? Question 16 options: sample containing 40 percent sand, 15 percent clay, and 45 percent silt sample containing 25 percent sand, 15 percent clay, and 60 percent silt sample containing 55 percent sand, 30 percent clay, and 15 percent silt sample containing 30 percent sand, 35 percent clay, and 35 percent silt
Answer:
The correct answer is - sample containing 30 percent sand, 35 percent clay, and 35 percent silt.
Explanation:
The loam soil is a type of soil that is made from an equal amount of all three components are; sand, silt, and clay. Loam can be distinct as medium loam with little variation of the percentage of the components.
This type of soil is very useful for creating soil for gardens or farm soils as it provided a nice hold on the moisture and also provide enough air to the roots due to drain well property.
Among all the options last option has almost the same amount of the components of the soil, sand - 30 %, silt - 35 %, and clay - 35%
Answer:The correct answer is - sample containing 30 percent sand, 35 percent clay, and 35 percent silt.
Explanation: