Which pronoun indicates first-person point of view?
OT
he
she
you

Answers

Answer 1

Answer:

its you !!!

yes, you ;)

. . . . . . . .. .... . ..


Related Questions

In which of these would you find microchips a computer a cellphone and/or a book

Answers

Answer:

A. WORD LIST

1. Microchips can be found in a computer and a cellphone

2. False. This is because Trigonometry is used to calculate angles.

3. Yes. I will definitely be looking at pixels. This is because pixel is known to be a dot or square on a display forms the screen image.

B. WORD STUDY

1. gravimetry

2. electrometry

3. optometry

4. symmetry

5. astrometry

Explanation:

The above answers are correct and accurate.

Microchips are actually found in computers and cellphones. In cellphones, microchips help users to track information. It is used in GPS as well.

The pixel is seen as a dot or square on a computer display screen. They are the basic building blocks of a digital image.

Trigonometry is a measurement system used in finding angles in a triangle.

Gravimetry is a system of measurement employed to study/measure the weight of substances like ions. Astrometry is a measurement of the precise positions of stars and celestial bodies.

3
In the middle of the charcoal grill, there was a charred steak.
What is the participle in the sentence?
OA. steak
OB. middle
OC. was
OD. charred

Answers

Answer:

OD.

Explanation:

charred


Robyn tests a sample of a mineral by rubbing it on a piece of white tile. She observes a yellow mark that is left on the tile. What property of minerals is
Robyn testing?
Streak
Ο Ο Ο
Color
Luster
Cleavage

Answers

Answer:

cleavage

Explanation:

means sharpness

Life has become so boring but it can become sweet by friends​

Answers

Answer:

yes so true

Explanation:

without our sweet friends life is really boring but with friends you will have all the joy in your life

Where does a thesis statement generally appear in an essay? HINT: It's not B.

A. By itself at the top of the page
B. In the first sentence in the introductory paragraph
C. Any place in the introductory paragraph
D. In the conclusion

Answers

By itself at the top of the page

Answer:

C. Any place in the introductory paragraph

Explanation:

Edmentum/Plato

Energy that moves from a warmer object to a cooler object is called ________.
heat
temperature
thermal energy
insulation

Answers

I choose Thermal energy

How do paragraphs 21-25 contribute to the development of ideas in the article?

Answers

Answer:

where's the article??

3a Developing reading skills aid in developing writing skills. List two aspects of reading that help in developing writing skills.​

Answers

Answer:

Developing reading skills can definitely aid in developing writing skills. Two aspects of reading that help in developing writing skills are:

1. Vocabulary: Reading, especially quality literature, exposes the reader to a wide variety of words and phrases that they may not encounter in their daily life or conversations. By regularly reading books, articles, or other written materials, individuals can increase their vocabulary and use them appropriately in their own writing.

2. Writing Style: By reading different authors with distinct writing styles and tones, individuals can learn to identify and appreciate different writing techniques and how they affect the overall effectiveness of a piece of writing. This exposure can help improve their own writing style, as they can incorporate some of the writing techniques they have learned into their writing to make it more engaging and effective.

"Arbor Day" and "Earth Day" are ___________________ conscious holidays.

(WILL GIVE BRAINLIEST)

Answers

Answer:

environmentally

Explanation:

on both holidays, we become aware of what has happened to the Earth and try out best to do what we can to prevent and slow the destruction of our environments

Pleasse help.
Tell me about 1 of the 4 techniques you identified in your essay.
eg AuthorName said "paraphrased or quote" which is an example of TechniqueName and my interpretation/understanding of this is ...

My essay:

Answers

Both William Wordsworth and John Muir celebrate the beauty of nature and its ability to bring happiness and joy into one's life, as seen in their respective works.

William Wordsworth and John Muir have both described nature as a beautiful and wonderful thing. Both William Wordsworth and John Muir also described how nature has a very powerful impact of being able to bring happiness and joy into someone's life, when they are having a bad day. William Wordsworth's poem "I Wandered Lonely as a Cloud" is an example of his view of nature. The poem uses nature to evoke feelings of joy and happiness in the reader. The poem describes the beauty of nature and how it can lift one's mood.
John Muir's "The Calypso Borealis" is another example of how nature can bring joy and happiness to one's life. In this poem, Muir describes his long and lonely excursion in nature. Although it may seem lonely, Muir finds joy in nature. He describes the plants in nature as beautiful and rare, showing how he views nature positively.
Both authors share a love for nature and describe it as a source of joy and happiness. They view nature as something beautiful that has the power to lift one's mood and bring joy into their life. Through their writing, they encourage people to appreciate nature and take advantage of the happiness it can bring.

For more such questions on William Wordsworth

https://brainly.com/question/5994807

#SPJ8

What is Rosenberg's main criticism of the play?

Answers

It can be inferred that Rosenberg's primary criticism of the play is that it is rife with unrealistic ideas of love. He used the adjective "childish" to describe it.

Who is Rosenberg?

Alyssa Rosenberg in this case is the person who was known for critiquing the play - Romeo and Juliet.

Thus, it is correct to state that Rosenberg's primary criticism of the play is that it is rife with unrealistic ideas of love. He used the adjective "childish" to describe it.

Learn more bout Rosenberg's at;:
https://brainly.com/question/4306296
#SPJ1

plssssssssssssssssssssssssssssssssss

Answers

Yes I can help you answer this

Please help me answer in own words the answer has to be based off the reading
In what way do you think Genesis is about the creation of seeing and loving beauty?
There should be NO references to morality.

Answers

Because God loves his creation and he loves man. When they fell into sin, he still loved them so he gave his only son to save us. He forgave us and saw the real beauty in humanity.

ct the correc answer Which of the following is a person versus society external conflict in the excerpt from Narrative of Sojourner Truth O A. Isabella is frustrated that the sunlight is so bright during her escape, Mr. Van Wagener does not agree with slavery even though it is practiced widely in the country OC. Dumont argues that Isabella should return with him to his house or at least give him her child D. Isabella is upset with herself for not having made a clearer plan for her journey Reset NEX​

Answers

The option that is a person versus society conflict is "Mr. Van Wagener does not agree with slavery even though it is practiced widely in the country."

What is a person vs society conflict?

First, let's understand that every time two forces oppose each other we have what is called a conflict. Those forces can be characters, phenomena of nature, society, etc.

In a person vs society conflict, we have a character in a story going against a societal behavior, belief, system, idea, etc. In this case, Mr. Van Wagener is going against society when he disagrees with the practice of slavery at a time when slavery was widely practiced and accepted.

With the information above in mind, we can choose option B as the correct answer.

Learn more about conflict here:

https://brainly.com/question/16601135

#SPJ2

Which statement would a Transcendentalist most likely agree with?
O A. A higher power decides our success or failure before we're even
born.
B. Life is short, so one should live it to its fullest no matter the costs.
C. No one is stuck in life; we all have the potential to grow as
individuals.
D. People are naturally selfish, so society should cater to that
impulse.

Answers

Answer:

D.

Explanation:

Transcendentalists believe things such as political parties and organized religion corrupt one's purity, and as such would agree with D.

Can somebody please help me if you don’t put an actual answer I will report you

Answers

Answer:

i am pretty sure it is a

Explanation:

hope this helps

Can someone give me a good starting claim why “women’s menstrual products should be free”

Answers

Answer: Women did not choose to have periods, and you can not do anything about it unless you have expensive surgeries.  Homeless women also can not have good hygiene if they don't have products to help with it, and most of them can not afford them because they can be pricey.

Hope this helps :)

Carmen is planning rail lines for a new train station.

Answers

Answer:

umm ;-; Ok any other information?? ur question is very incomplete...

Explanation:

Answer:

m<1 =163 degrees

163,17,163,17 (all in degrees)

163,17,163,17  (all in degrees)

Explanation:

I have duplicated and joined a chart (in figure 1) of the issue.  

For simplicity of comprehension, I have connected a second outline which is named.  

On line a  

17+<CBE=180 (Linear Pair Postulate)  

m<2=<CBE=180-17=163 degrees  

<ABG=<CBE=163 degrees (Vertically Opposite Angles)  

<ABE=<GBC= 17 degrees(Vertically Opposite Angles)  

On line b  

m<1=<DEB=<ABG=163 degrees (Corresponding Angles)  

<BEF=<GBC= 17 degrees (Corresponding Angles)  

<HEF=<DEB=163 degrees (Vertically Opposite Angles)  

<DEH=<BEF=17 degrees (Vertically Opposite Angles)  

Accordingly:  

m<1 =163 degrees  

Clockwise from upper left, the points shaped with line an are: 163 degrees, 17 degrees, m<2=163 degrees and 17 degrees.  

Clockwise from upper left, the points shaped with line b are: m<1=163 degrees, 17 degrees, 163 degrees, and 17 degrees.

use these words in a short story

Answers

Answer:

I never believed that someone could be truly cold-hearted. I thought that even the worst people must have had some amount of good in them. Once I first heard about (random name), though, my thoughts started to change. Hearing about the savagery of their actions was the start. Then I saw (random name) for the first time. They were swaggering down the path in an uncaring but confident manner, as though they had done no wrong. I stood tongue-tied, watching them get closer and closer, then I realized (random name) was walking towards me!

11. Decide if the statement is true or false.
A universal theme is specific to one story.
True
False
True or false??

Answers

Answer:

false

Explanation:

Answer:

This is false.

Explanation:

2. What is the proper way of
washing hands?

I suppose__________​

Answers

Answer:

thoroughly rub soap all across your hands and wrists. Be sure to scrub your hands together under running water for at least 20 seconds, getting under your nails as well.

Pretty please help !!

Answers

I hope this helps i’m not for sure on the bottom but i believe the top is correct.

6. Write one paragraph to explain whether you agree or disagree with celebrities using their social media presence/fame to express their opinions. Be sure to cite evidence from the texts.

Answers

I feel like influencers have the right to express their opinion. They’re helping spread word about BLM, ASIAN LIVES MATTER, and many more. Like Charli D’amelio, she uses her platform to speak about what’s happening to today like People of color dying from police officers and she should have the right to post and preach about these things.

6.Do you think that Bryan Stevenson is a role model for young
people male and female?

Answers

Yes because everyone should be treated equally

The poem opens with the line "The buzz saw snarled and rattled in the yard" is an example of what kind of sound device?

Answers

Answer: Onomatopoeia

Explanation:

I took it

Hhhheeeeeelllllppppp

Answers

Answer:

Ali has too much clothes in his wardrobe.

I've decided to prepare something special for dessert.

Explanation:

I really hope this helps!

:)

Read the following paragraph, which is missing a topic sentence:
Studies show that buckling up reduces the odds of dying in a vehicle accident by about 50%. The National Highway Traffic
Safety Administration says that almost 300,000 lives have been saved by seat belts since 1975. If that isn't reason enough to
"click it," driving without a fastened seat belt can get you pulled over in most states and ticketed in all of them.
Which is the most effective topic sentence for the paragraph?
O Modern cars are safer than ever but driving is still dangerous.
O Seat belts are important for many reasons.
O Car crashes are the leading cause of death for Americans under the age of fifty-five.
O Many people think that they shouldn't have to wear a seat belt if they don't want to.

Answers

Answer:

Seat belts are important for many reasons.

Explanation:

The first evidence is about how seatbelts reduce the odds of dying in an accident

Second one is that seatbelts have saved 300,000 lives since 1975

Last one is that not wearing a seatbelt can have legal consequences

all of them give reasons for wearing a seatbelt/why they are important

Topic sentences are the main idea expressed in the paragraph. Seat belts are important for many reasons and can be the most effective topic sentence.

What are topic sentences?

A topic sentence is used in expository writing to summarize the central idea of the content. It delivers the author's personal opinion on the paragraph.

As the paragraph discusses the importance and advantage of seatbelts thus, the topic sentence must include the benefits of seatbelts. It states the significance and benefits of using a seatbelt while driving and compares it traffic data.

Therefore, option B. Seat belts are important for many reasons and is the most effective topic sentence.

Learn more about the topic sentence here:

https://brainly.com/question/1771002

#SPJ2

"He got up on the wrong side of the bed this morning" is an example of...
simile
alliteration
idiom
metaphor​

Answers

Answer:

Its an example of an idiom

Explanation:

Answer:

it is a Metaphor

Definition: is a condition in which your immune system mistakenly attacks itself.
Which word below belongs to this definition?
(1 Point)
Autodegrade
Autoimmune

Answers

The answer above is a bot account trying to give your device a virus!!! Please do NOT click the link. The answer to your question is autodegrade.

What evidence is there to support her (Thelma’s) point of view on the novel? Provide at least 2 examples from the text and explain the connection.


Based on the review, what are your initial thoughts on this book? Does it “peak” your interest? Why or why not? You can be honest!


Questions for the book, "The House on Mango Street"

Answers

Answer:

i have no clue

Explanation:

Other Questions
In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=???? Which of the following expressions are equivalent to 10 12? Choose all answers that apply: . 2.5 - 6 B.2(5 - 6) C.None of the above