d)Both answers are incorrect because they did not place the same units in the same positions in the ratios. Comparing the solution methods of Jane and Ivana, it is clear that their approaches differ in terms of the arrangement of units in the ratios.
Jane's solution method involved setting up a proportion with quarts in the denominator and servings in the numerator.
This implies that Jane established the ratio of servings to quarts.
Her reasoning might be that the number of servings is dependent on the amount of quarts available, which aligns with common sense.
By placing the units in this order, Jane aimed to determine the number of servings corresponding to a certain quantity of quarts.
On the other hand, Ivana approached the problem differently by setting up a proportion with quarts in the numerator and servings in the denominator.
This indicates that Ivana established the ratio of quarts to servings.
Her reasoning might be that the amount of quarts is the primary factor, and the number of servings can be calculated based on that quantity.
Ivana placed the units in this order to determine the amount of quarts required to obtain a specific number of servings.
Since Jane and Ivana arranged the units in different positions within their ratios, their solutions cannot both be correct.
One of them may have arrived at the correct answer, while the other's approach led to an incorrect result.
Without further information about the problem or their specific calculations, it is impossible to determine which solution is correct or if both are incorrect.
For more questions on ratios
https://brainly.com/question/12024093
#SPJ8
cystic fibrosis is a genetic disease that leads to the production of excessive thick mucus in the respiratory tract, leading to frequent and serious respiratory infections. the defect is due to the production of a faulty membrane protein for the transport of the chloride ion. the protein is still in the membrane; it just doesn't function normally. what type of membrane protein is being affected in this case?
The type of membrane protein that is affected in cystic fibrosis is a chloride ion channel.
What is Cystic fibrosis?Cystic fibrosis is an inherited condition in which the mucus in the body becomes thick and sticky. It can cause breathing difficulties and frequent infections, among other symptoms. Because the mucus is thicker than normal, it can obstruct the ducts of the pancreas, preventing digestive enzymes from reaching the small intestine.Cystic fibrosis is an autosomal recessive genetic disorder.
This means that in order to inherit the disease, a person must inherit two copies of the mutated gene, one from each parent.
What is the cause of cystic fibrosis?Cystic fibrosis is caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane conductance regulator. This protein functions as a chloride ion channel, which helps regulate the flow of salt and fluids in and out of cells.
However, in people with cystic fibrosis, the CFTR protein is either missing or not functioning properly due to a genetic mutation. As a result, the salt and water balance is disrupted, leading to the production of thick, sticky mucus that clogs the airways, digestive tract, and other ducts in the body.
To know more about cystic fibrosis, refer here:
https://brainly.com/question/31366825#
#SPJ11
 HURRY I HAVE A TIME LIMIT!
Humans, cats, whales, and bats all have similar arm bones. What piece of evidence for common ancestry does this describe?
-homology
-embryology
-fossil record
-amino acids sequences
Answer: that they all have the bones used to make their movements so they can live and survive on there own.
Explanation:
What are the factors that increase a species success over time.
Answer:
Explanation:
(1) the potential for a species to increase in number,
(2) the heritable genetic variation of individuals in a species due to mutation and sexual reproduction,
(3) competition for limited resources
(4) the proliferation of those organisms that are better able to survive and reproduce in the environment
Hope this helped!!!
Why do some organisms produce many more offspring than other organisms?
What do tornadoes and hurricanes have in common
☁️ Answer ☁️
"Tornadoes and hurricanes appear to be similar in their general structure. Both are characterized by extremely strong horizontal winds swirling around the center, strong upward motion dominating the circulation with some downward motion in the center. "
1. Death
2. strong horizontal winds swirling around the center
3strong upward motion dominating the circulation with some downward motion in the center.
Hope it helps.
Have a nice day noona/hyung.
What causes the change from day to night and vice versa?
A. The orbit of the sun around Earth.
B. The moon's rotation around Earth
C. The rotation of Earth on its axis.
D. The orbit of Earth around the sun
Answer:
c? if u stand infront a light and spin, the opposite side to the light would be dark?

bynummeeks24
10/08/2020
BiologyHigh School
answered
Which of the following best describes how a channel protein moves materials across the membrane? A)They provide a carrier for specific molecules to bind to and cross the membrane via endocytosis. B)They provide a passage for specific molecules to cross the membrane via passive transport. C) They provide a tunnel for solutes to cross the membrane via active transport. D) They provide energy needed for solutes to cross the membrane via facilitated diffusion.
The correct option that best describes how a channel protein moves materials across the membrane is B) They provide a passage for specific molecules to cross the membrane via passive transport.
Channel proteins are integral membrane proteins that form channels or pores in the cell membrane. These channels allow the passive transport of specific molecules or ions across the membrane down their concentration gradient. This process is called facilitated diffusion, where the molecules move from an area of higher concentration to an area of lower concentration without the need for energy input. The channel proteins provide a selective passage for these molecules, enabling their movement across the membrane.
Therefore, the correct answer is B) They provide a passage for specific molecules to cross the membrane via passive transport.
For more details regarding passive transport, visit:
https://brainly.com/question/29764225
#SPJ4
I
rupe de estudiante utiliza un aparate para estudia
reaction quimica entre pedande cascara de bo
acetico, me muestra la siguiente ilustracion
ar la transferencia de energia durante la
de camara de hormierhonate de calcio vare
Experimento con vinagre y cáscara de huevo
Burbujas
Burbujas
Burbujas
de
Tubo
de
vidrio
Tubo
de
vidrio
vidno
Cáscara de
huevo
Vinagre
Cáscara de
huevo
Vinagre
3
Cáscara de
huevo
Vinagre
5%
Durante el experimento, utilizan la misma masa de cascara de huevo, pere varian la
concentración del vinagre.
A. Explica por yue la transferencia de energia no es la misma entre las tres pruebas del
experimente
B. Describe como se podria modificar el aparato para que pueda medir con MAYOR
EXACTITUD la transferencia de energia en cada reacción.
Recuerda contestar todas las partes de la pregunta en el espacio previsto
A. La transferencia de energía no es la misma entre las tres pruebas del experimento debido a la variación en la concentración de vinagre.
La concentración del vinagre influye en la velocidad y la eficacia de la reacción química. El vinagre es una solución diluida de ácido acético en agua, y el ácido actúa para disolver la capa externa de carbonato de calcio que compone la cáscara del huevo. Cuanto mayor sea la concentración de ácido acético en el vinagre, más rápida será la reacción y mayor será la transferencia de energía. Por lo tanto, se puede observar que la prueba que utilizó la concentración de vinagre al 10% tuvo una transferencia de energía mucho más alta que las otras dos pruebas.B.
El aparato se puede modificar para medir con mayor exactitud la transferencia de energía en cada reacción. Esto se puede hacer utilizando un calorímetro, que es un dispositivo que se utiliza para medir el calor de las reacciones químicas o los cambios físicos. El calorímetro consta de un recipiente aislado que contiene una muestra y se coloca en un baño de agua. Se mide la temperatura del agua antes y después de la reacción, y la diferencia en la temperatura se utiliza para calcular la cantidad de calor absorbido o liberado por la muestra.
To know more about tres visit:
https://brainly.com/question/1098271
#SPJ11
7. Based on what you know about Carbon Dioxide (look at the definitions section) and the Description of the Landscapes, how did the amount of Carbon Dioxide in the atmosphere increase over time? 8. Carbon Dioxide and Water vapor are greenhouse gases. How do greenhouse gases act like the glass in greenhouses?
Answer: Carbon dioxide levels today are higher than at any point in at least the past 800,000 years. Global atmospheric carbon dioxide concentrations (CO2) in parts per million (ppm) for the past 800,000 years. ... Carbon dioxide concentrations are rising mostly because of the fossil fuels that people are burning for energy. The large numbers of land animals raised to feed the Earth's growing population results in increased carbon dioxide levels in the atmosphere due to farming practices and respiration and methane production. This is another example of how human activity indirectly affects biogeochemical cycles in a significant way. 8. Gases in the atmosphere, such as carbon dioxide, trap heat similar to the glass roof of a greenhouse. These heat-trapping gases are called greenhouse gases. During the day, the Sun shines through the atmosphere. Earth's surface warms up in the sunlight. Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse.
Explanation:
How might change in one population affect other populations?
Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3´
The correct mRNA sequence transcribed from the given DNA sequence is: 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' Here option B is the correct answer.
To determine the correct mRNA sequence transcribed from the given DNA sequence, we need to apply the rules of DNA transcription. During transcription, the DNA sequence is used as a template to synthesize an mRNA molecule, with the RNA base uracil (U) substituting for thymine (T) in the DNA.
The given DNA sequence is:
5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'
To transcribe this DNA sequence into mRNA, we replace each DNA base with its RNA counterpart:
G (Guanine) → C (Cytosine)
C (Cytosine) → G (Guanine)
A (Adenine) → U (Uracil)
T (Thymine) → A (Adenine)
Applying these conversions, we get the mRNA sequence:
5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
Therefore, option b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3' represents the correct mRNA sequence transcribed from the given DNA sequence.
To learn more about mRNA
https://brainly.com/question/29314591
#SPJ4
Complete question:
Which of the following represents the correct mRNA sequence transcribed from the given DNA sequence?
a) 5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3'
b) 5' UCCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
c) 5' CCCUAGCUACGGGAUUUUCUCAAUAUGUAAUUGACCUCCGCAAUGGGGCUCC 3'
d) 5' GGGATCGATGCCCCTTAAAGAGUUUACAUUAUUGCUGGAGGCGUUAACCCCGGA 3'
write the two functions of blood?
Explanation:
regulating body temperature
forming blood clots to prevent excess blood loss
Enzymes are composed of what organic molecule?
a. sugars
b. DNA
c. proteins
d. lipids
Answer:
Proteins
Explanation:
Among the organic macromolecules, enzymes belong in the category of proteins. Proteins are distinct from carbohydrates, nucleic acids, and lipids in that a protein is made of amino acids. Amino acids link together into a chain that can fold into a three-dimensional shape.
Explain the difference between DNA, chromosomes, genes, and the protein that is created.
I NEED THIS QUICKLY PLS!!!
Explanation:
DNA is a long molecule that contains our unique genetic code.DNA is composed of two strands that wrap around each other to form a double helix shape.
Genes are sections of DNA that contain the set of instructions to produce one specific molecule in your body, usually a protein. These proteins control how our body grows and works; they are also responsible for many of our characteristics, such as our eye colour, blood type or height.
Chromosomes are bundles of tightly coiled DNA located within the nucleus of almost every cell in our body. Humans have 46 chromosomes . We inherit one set of 23 chromosomes from our mother and one set of 23 chromosomes from our father. So we have two sets of 23 chromosomes or 23 pairs.
Light traveling through the air moves in a straight line. An object viewed through water looks different because light rays that travel through water are . . .
A.bent
B.reflected
C.bounced
B.absorbed
State the most probable cause for each of the following scenario:
A student is having difficulty interpreting the reagent strip color reactions on a thick orange specimen.
The most probable cause for a student having difficulty interpreting the reagent strip color reactions on a thick orange specimen is a large amount of urobilinogen.
What are reagent strips?Reagent strips, also known as urine dipsticks, are used to check for various substances in urine. They are thin, plastic strips with pads on the end that are coated with chemicals that react with substances in the urine.
When urine comes into touch with the pads on the reagent strips, the chemical coating on the pads changes color to indicate the presence of particular substances in the urine. The colors of the pads on the strips are compared to a color chart to determine the amounts of substances in the urine.
Therefore, if a student is having difficulty interpreting the reagent strip color reactions on a thick orange specimen, the most probable cause is a large amount of urobilinogen. Orange or brown urine with a high amount of urobilinogen, which is caused by an excessive breakdown of red blood cells, might cause the color of the specimen to become thick orange. This might make it tough for a student to interpret the color reactions of the reagent strips.
Learn more about reagent strip: https://brainly.com/question/32403321
#SPJ11
what is the relationship between the rate of wind and the amount of abrasion?
Answer: Wind speed is also important. The rate of erosion caused by a 30-mile-per-hour wind is more than three times that of a 20-mile-per-hour wind. Wind erosion decreases as soil moisture increases. For example, dry soil erodes about one-and-one-third times more than soil with barely enough moisture to keep plants alive.
Explanation:
https://www.agry.purdue.edu/soils_judging/new_manual/ch6-wind.html Hope this helps
Can humans turn into fossils why or why not?
Answer:
Certain types of animals are more likely to end up as fossils. ... On the other hand, it turns out humans are actually fairly well-suited to becoming fossils. “Mammals have a very good record, because teeth make fantastic fossils,” says Norell. “They're incredibly hard, incredibly resilient.
Explanation:
Answer:
well probably we humans are almost, practically fit for fossils so we have a chance to turn into a fossil
Explanation:
I Will Mark Brainliest
Which of the following is the broadest taxonomic category?
A
phylum
B
class
C
genus
D
domain
Answer:
I think it's A- phylum, hope this helps
alpha-defensins and reactive oxygen species (ros) are examples of anti-microbial molecules produced by professional phagocytes, which can function by breaking down and killing phagocytosed pathogens. True or false
True. Alpha-defensins and reactive oxygen species (ROS) are examples of anti-microbial molecules produced by professional phagocytes, which can function by breaking down and killing phagocytosed pathogens
Alpha-defensins and reactive oxygen species (ROS) are indeed examples of antimicrobial molecules produced by professional phagocytes, such as neutrophils and macrophages. These molecules play a crucial role in the immune response against invading pathogens.
Alpha-defensins are small peptides that possess antimicrobial properties. They can directly kill microorganisms by disrupting their cell membranes, leading to their lysis or death. These defensins are produced by various immune cells, including neutrophils, and contribute to the elimination of pathogens during phagocytosis.
Reactive oxygen species (ROS), including superoxide anion, hydrogen peroxide, and hypochlorous acid, are generated by phagocytes during the process of phagocytosis. ROS are highly reactive molecules that can damage microbial components, such as proteins and DNA, leading to the killing or inactivation of phagocytosed pathogens.
Therefore, both alpha-defensins and reactive oxygen species are antimicrobial molecules produced by professional phagocytes that function by breaking down and killing phagocytosed pathogens.
To know more about alpha-defensins follow the link:
https://brainly.com/question/31415238
#SPJ4
The diagram below shows the first four steps of meiosis.what's is happening in step labeled c?
Why do the temperatures change over the months?
O A. Because the Moon is tilted on its axis, it reflects more sunlight on Earth during different times of Earth's yearly orbit.
B. Because the Sun is tilted on its axis, parts of Earth get more sunlight during different times of Earth's yearly orbit.
O C. Because Earth is tilted on its axis, the stars reflect more light during different times of the Earth's yearly orbit.
D. Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit.
Answer:
Answer
Explanation:
B because the more the sun is titled the more heat=different season.
Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit. As Earth orbits around the Sun, its axis is tilted at an angle of about 23.5 degrees. Hence the correct option is D.
Why do the temperatures change over the months?The temperatures change over the months primarily because of Earth's axial tilt. As the Earth rotates around the sun, the angle at which sunlight hits different parts of the Earth changes.
This is because the Earth's axis is tilted about 23.5 degrees relative to its orbit around the sun. When a particular hemisphere is tilted toward the sun, it receives more direct sunlight, resulting in warmer temperatures.
Conversely, when that hemisphere is tilted away from the sun, it receives less direct sunlight, resulting in cooler temperatures. This cycle repeats itself annually, causing changes in temperatures over the months.
Hence the correct option is D.
To know more about Earth's axis:
https://brainly.com/question/14639935
#SPJ2
which of the following would not be a teratogen? question 18 options: cigarettes lead rubella (german measles) steak
The following would not be a teratogen among cigarettes, lead, rubella (german measles), and steak is steak. Teratogens are substances that interfere with prenatal development and can lead to birth defects. Cigarettes, lead, and rubella are known teratogens that can cause significant harm to a developing fetus. However, steak is not a teratogen.
Cigarettes are a teratogen because they contain harmful chemicals that can cross the placenta and interfere with fetal development. These chemicals can increase the risk of low birth weight, premature birth, and birth defects such as cleft palate and heart defects.
Lead is also a teratogen because exposure to high levels of lead during pregnancy can lead to developmental delays, learning disabilities, and other cognitive impairments in children. Lead can be found in contaminated water, soil, and household items such as paint and dust.
Rubella, or German measles, is another teratogen that can cause severe birth defects if a woman becomes infected during pregnancy. Rubella can cause deafness, blindness, heart defects, and intellectual disability in a developing fetus.
Steak, on the other hand, is not a teratogen. While some types of food, such as undercooked meat and raw eggs, can be harmful during pregnancy due to the risk of foodborne illness, properly cooked steak is not a teratogen and does not pose a risk to fetal development.
know more about Teratogens click here:
https://brainly.com/question/28815393
#SPJ11
What are all of the secondary consumers included in this web?Herring
Sprat
Gray seal
Saduria entomon
Monoporeia affinis
A scientist observes the cells of a newly discovered organism under a microscope. The organism has mitochondria, a cell wall, lysosomes, and ribosomes. Is this organism a plant or an animal, and how do you know? A. The organism is a plant, because it has lysosomes. B. The organism is an animal, because it has mitochondria. C. The organism is a plant, because it has a cell wall. D. The organism is an animal, because it has ribosomes.
Answer:
think the answer is:
C. The organism is a plant because it has a cell wall.
Explanation:
only plant cells have Cell Walls
state two factors on which the gravitational force between two objects depends.
Answer:
Gravitational Force depends on two factors:
1. Product of mass of two object
2. Square of distance between their centers
Mathematically,
F = G *(m1* m2)/d²
Explnation:
How do toothed whales produce echolocating sounds?
Answer:
Toothed whales (including dolphins) have developed a remarkable sensory ability used for locating food and for navigation underwater called echolocation. Toothed whales produce a variety of sounds by moving air between air-spaces or sinuses in the head.
Explanation:
Answer:
Toothed whales can direct sound by bouncing it off air sacs in their nose and possibly by using face muscles to alter the shape of the melon.
Explanation:
3. Which organism has DNA located in three organelles?
A. A sponge
B. A fern plant C. A flatworm
D. A bacterium
In a FERN PLANT, DNA is located in three different organelles (Option B).
Plants are organisms that have chloroplasts, mitochondria, and cell nuclei.In a eukaryotic cell, the genetic material (i.e., DNA) is mainly found in the nucleus, which is an organelle bounded by a double-membrane (bacteria don't have nuclei).However, mitochondria and chloroplasts are also membrane-bound organelles that have their own genetic material.Chloroplasts are only found in plants and algae (sponges and flatworms don't have chloroplasts).In conclusion, in a FERN PLANT, DNA is located in three different organelles (Option B is correct).
Learn more in:
https://brainly.com/question/11136550?referrer=searchResults
1. Explain why the greenhouse effect is necessary but how an enhanced greenhouse effect can harm the planet.
2. Define global warming and explain what has caused the recent trend of warming that the earth is experiencing.
3. Explain why Earth's temperature is directly affected by the amount of greenhouse gases in the atmosphere.
4. Define carbon sequestration and explain how deep geologic burial of carbon works.
5 Describe the connection between fossil fuel burning, the melting of polar ice, and the rising of global sea levels.
Answer:
1. The enhanced greenhouse effect disrupts the Earth's climate equilibrium and has led to an increase in the global average surface temperatures.
2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect" 1 — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping.
3. Greenhouse gases absorb some of the energy and trap it in the lower atmosphere. Less heat radiates into space, and Earth is warmer. ... Carbon dioxide, methane, water vapor, and nitrous oxide are naturally present in Earth's atmosphere.
4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change.
5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. ... Scientists have found that water draining from melting glaciers and ice sheets in polar and mountain regions is now also contributing to this rise in sea levels.
Answer: 1. Necessary because it keeps heat in and keeps the planet at the right temperature for life.
It can harm the planet if more pollution occurs and the greenhouse gas effect traps too much heat and causes global warming. 2. Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"1 — warming that results Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. The greenhouse effect keeps Earth's climate comfortable when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. 3. Human activities contribute to global warming by increasing the greenhouse effect. ... Greenhouse gases let the sun's light shine onto the Earth's surface, but they trap the heat that reflects back up into the atmosphere. In this way, they act like the insulating glass walls of a greenhouse. 4. Carbon sequestration is the process of capturing and storing atmospheric carbon dioxide. It is one method of reducing the amount of carbon dioxide in the atmosphere with the goal of reducing global climate change. Geologic carbon sequestration is the process of storing carbon dioxide (CO2) in underground geologic formations. The CO2 is usually pressurized until it becomes a liquid, and then it is injected into porous rock formations in geologic basins. 5. As climate change caused by burning fossil fuels drives temperatures higher, the ocean warms, causing it to expand. This expansion in turn causes sea levels to rise. ... There is now so much warming baked in to the global climate system that sea levels will continue to rise for centuries.
Explanation:
4. The diagram below represents one possible immune response that can occur in the human body.
**The structures that are part of the immune system are represented by
A, only
A and C, only
B and C, only
A, B, and C
5. Explain your answer to the previous question
Answer:
A and C only
Explanation:
I'm sorry I don't know how to explain it but trust me its A and C only.