Why are models often used in science

Answers

Answer 1

Answer:

Models use familiar objects to represent unfamiliar things. Models can help you visualize, or picture in your mind, something that is difficult to see or understand. Models use familiar objects to represent unfamiliar things.

Explanation:

Models can help you visualize, or picture in your mind, something that is difficult to see or understand. Models can help scientists communicate their ideas, understand processes, and make predictions


Related Questions

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?

Answers

This is the complete question.

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor

in their work that could increase their chances of cancer?

A. Scientists who work with toxic chemicals

B.therapist who operate radiation machine

C.nurses who treat patients with viral infections

D.researches who study DNA replication

Research that study DNA replication. Thus, option "D" is correct.

What is cancer?

Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.

Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.

Thus, option "D" is correct.

To learn more about Cancer click here:

https://brainly.com/question/8590464

#SPJ1

3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true ​

Answers

Answer:

reproduction

Explanation:

different traits

Which of the following is a natural resource for humans?

A-Cars
B-Electricity
C-Houses
D-Wood

Answers

D. Wood

Wood is a natural resource whereas everything else isn’t.

another name for the cell, or plasma, membrane

Answers

Another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).

What is the plasma membrane?

The plasma membrane is a physical barrier that separates the cell from its surrounding environment.

This barrier (plasma membrane) is fundamental to maintain the internal homeostasis state of the cell.

In conclusion, another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).

Learn more about the plasma membrane  here:

https://brainly.com/question/734740

#SPJ1

One possible reason for the rise in the average air temperature at the Earth's surface is that

Answers

Answer:

cimate change

The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which

Answers

Fatty acid tails = hydrophobic
Phosphate heads= hydrophilic

Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent

Answers

the correct answer is detergent which is not approved

The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.

What is a hand sanitizer?

Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.

Detergents are not approved during the formation of hand sanitizer.

Thus, the correct option for the given scenario is D.

For more details regarding sanitization, visit:

https://brainly.com/question/4296165

#SPJ2

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.

Answers

A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

What are salinity and conductivity measurements?

Salinity is a measure of the salt content of a water body.

Conductivity is a measure of the electrical conductivity of a solution or substance.

Conductivity increases with increase in salinity.

An estuary is a region where salt water from the sea meet freshwater from a river or stream.

At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.

Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

Learn more about salinity and conductivity at: https://brainly.com/question/2472580

#SPJ1

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).

The backbone is also known as the vertebral column. Justify in accordance with both the
terms used

Answers

dont say babe lol is it bc i’m black no hehehe rawr im doing this so i can literally get answers for this thing

Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?

Answers

The correct options would be B and E.

Variation in population size

The population size of each organism in different zones may not vary much due to the following:

Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.

More on adaptations of organisms can be found here: https://brainly.com/question/1686177

#SPJ1


How might compound leaves and leaves with lobed margins be well-suited to windy environments?

Answers

Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

What is a plant adaptation?

A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.

Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.

In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

Learn more about plant adaptations here:

https://brainly.com/question/29594

#SPJ1

10 points!

A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.

Answers

Answer:

it’s a spore

Explanation:

it should be a spore. It’s because the spore is the haploid.

Which feature of the ocean floor includes its deepest parts?

Answers

Ocean Trenches also known as Deep Sea Trenches

For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?

Answers

Answer:

Some bacteria have mutated and are not killed by the penicillin

Explanation:

Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?

Answers

The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.

What is Taxonomic classification system?

This is defined as the classification of organisms based on shared characteristics.

This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.

The complete question is:

Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.

Which of the following best explains why a standardized classification system is important to the scientific community?

Read more about Taxonomic classification system here https://brainly.com/question/11724129

#SPJ1

We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous

Answers

Answer:

We can mold metals into different shapes because they are _malleable__.

Explanation:

Malleable (ability to be hammered into thin sheets)

An organism that is eaten by a predator is

Answers

Prey is a term given to the organism that is eaten by the predators.

Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation

I'll give brainly to whoever response is good !
please help me :C

Answers

Answer:

At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.

What factors can limit growth?

competition
amount of sunlight or water
r-selected species
geographic borders

Answers

The answer is

Amount of sunlight or water.

As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.

learn more things about what factors growth

https://brainly.com/question/3944507

Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease

Answers

Answer:

escribe a trophic cascade (at

least three organisms long)

that would occur if the orca

whale population were to decrease

Explanation:

You are provided with three liquids - Water, honey and oil. On pouring the three liquids simultaneously without disturbing. What will be the arrangement of these liquids from top to bottom and why? Conduct this experiment at home and paste the picture of it with proper labeling​

Answers

Answer:

Honey would be on the bottom, water in the middle, and oil on the top.

Explanation:

Honey is on the bottom because it has a is greater density than water, and oil is on the top because it has less density than water.

It all depends on the viscosity of the materials. Honey on the bottom, oil floating on top and in the middle is water.

What kind of liquids float on water ?

The liquids which are in lesser weight just floats over the surface of water.

In the attached image it can be seen clearly that the denser of all is honey which has the property of viscosity as well and it just settles down on the surface whereas the lighter of all is the oil which is seen floating on the surface.

Oil and Water  is usually the most common  type of example of the two  types of immiscible liquids.  In this no matter what quantity you mix  the oil and water in that  they do not mix up . The reason why  this happens is as of the basic  chemical nature of  the oil and  the water molecules.

Learn more about miscible liquids at :

https://brainly.com/question/2193479

#SPJ2

what would most likely happen if a person increased the amount of saturated fat in his or hers diet?

Answers

Answer: If a person increased the amount of saturated fat in his or her diet there is a chance of risk of cardiovascular disease would increase.

Explanation: Increase in the amount of saturated fat in diet results in the increase of levels of cholesterol in blood. This cholesterol is in the form of LDL.

If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.

What is the harmful effect of saturated fatty acids?

Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.

Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..

Learn more about the harmful effects of saturated fatty acids here.

https://brainly.com/question/14118324

#SPJ2

What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional

Answers

Answer: (directly proportional)

the reason is the because the meaning of directly proportional is one increasing & decreasing at different rates. when a population takes resources the population grows but the resources sink but not in the same rate unless it would be inversely proportional if the population was increasing and decreasing at the same exact time as the resources

Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?

A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers

Answers

Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.

How, explain your answer briefly?

The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds.

The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

Thus, option "D" is correct.

To learn more about salmons click here:

https://brainly.com/question/16208604

#SPJ1

4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.

Answers

Answer:

A is the answer

Explanation:

please mark me as brainlist

Which of the following best explains how monkey is able to exchange gases with its environment and deliver oxygen throughout its body?

Answers

The ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.

What is respiratory system?

The respiratory system is defined as one of the body systems that are made up of a network of tissues and organs that aid in the exchange of carbon dioxide and oxygen.

The oxygen passes from the environment into the nostrils. It is then conveyed by the trachea to the bronchi and arrives at the alveoli where the oxygen is delivered to the body cells.

Therefore, the ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.

Learn more about respiration here:

https://brainly.com/question/18169685

#SPJ1

. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection

Answers

A. Reproduction. Single celled organisms make copies of themselves through mitosis which describes the function of the cell cycle

how can global warming lead to changes to the Earth's surface?

Answers

Answer:

It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.

Other Questions
Medium tones can look like what in a graphite drawing?A. WhiteOB. GreyOC. YellowD. Black 20 POINTS FOR THE CORRECT ANSWERCharlotte has just been given a big project that includes printed pieces and a website. While she is excited about the project, she is concerned about creating colors that match on screen and when printed, especially because the client has asked her to use a dark blue as one of the colors. Charlotte needs to create the colors in the appropriate color models. What should Charlotte consider?Help Charlotte determine which color models should be used for her project. Explain why you chose each color model. Could you have chosen another color model? Why? What advantages did the color model you chose have over any of the other choices? HELPPPPPPP ASAPPP!! Use the given scale factor and the side lengths of the scale drawing to determine the side lengths of the real object Which sentence has a word cholce error?OA We went to the humane society to select our new companion.OB. We sent to the human society to select our new companion What is the solution for x in the equation?-2x + 14 + 10x = 34A. B. C. D. help me to solve maths in your community on the negative impact of strikes as a socio economic issue on businesses Which of these Gothic conventions is depicted in Percy Bysshe Shelleys verse drama The Cenci?A. supernatural eventsB. obsession with the pastC. ancestral curseD. age-old propheciesE. evil villain how was the end of the Vietnam war treated in the U.S ? how did soldiers returning from the war feel?I will give brainlist and follow please help help For this graph, mark the statements that are true.M-1-A. The range is the set of all real numbers.B. The domain is the set of all real numbers.C. The domain is the set of all real numbers greater than or equal to-2.D. The range is the set of all real numbers greater than or equal tozero. You pick a card at random. 3 4 5 what is p(not less than 5)? write your answer as a fraction or whole number. How believable is a story like "The Cold Equations"? What examples from the story make you think this? Explain your answer in three to fivesentences. Yesterday afternoon, when i _________ home i ______ my homework What are the gender roles of males vs females of farmers in ancient China? Why do you think informal language changes over time? check all of the boxes that apply. people can borrow or modify words from other languages for their own use. developments in science and technology create new words and expressions. different generations use informal language in different ways. popular culture, such as movies, music, and sports, creates new words and expressions. Select the correct text in the passage. What is the opportunity cost in this Scenario? Harry has been very busy at work for the past two weeks, He has been working Weekends too. Finaly, he is going to get a weekend originally. he planned to paint his apartment that weekend. He also considered going fishing for the weekend. But then his parents called and asked him to come for dinner because it has been a while since they have seen each other Later on. his friend Theo informed him abaut a surprise birthday party for another friend. Theo plans to reserve a room at a restaurant for the celebration, with the cost to reserve the room split between Theo, Harry, and three other friends. Now Harry is confused about what he should do over the weekend. He decides that. for him, the mast important commitments are going over to his parent's house and attending his friend's birthday party. In the end, Harry decides to see his parents. Which sentence uses end punctuation correctly?O Did Mr. Reynolds ask Danielle to run for class president.O Did Mr. Reynolds ask Danielle to run for class president,Did Mr. Reynolds ask Danielle to run for class president?Did Mr. Reynolds ask Danielle to run for class president! 15 Points, please help me dude I keep getting troll answers. The first term in an arithmetic sequence is -3. If the sequence has a common difference of 8, what is the 30th term in the sequence?Will give brainliest to right answer :)) Which equation matches the graph of the greatest integer function givenbelow?