Will my belly overhang go away?

Answers

Answer 1

An apron belly cannot be spot treated. One can only be reduced through overall weight loss and surgical and non-surgical procedures.

How long does it take to get rid of a hanging stomach?

The best way to lose belly fat and have a flat tummy is to create a calorie deficit by eating less and exercising more for at least 6 to 12 weeks. You need to adhere to your food and exercise routine over that time with greater rigor and consistency if your abdominal fat is particularly resistant to change.

What causes a belly that hangs over?

You might have too much skin, fat, and tissue hanging down from your abdomen as a result of pregnancy, weight loss, or weight increase.

To know more about  belly fat visit:-

https://brainly.com/question/17927115

#SPJ4


Related Questions

Alana wants to join her school soccer team. She already has great cardiorespiratory endurance but wants to focus on some of the skill-related components of fitness. Define either coordination or agility and then describe how it will enhance Alana's soccer abilities. (6 points) Your answer:

Answers

Answer:

Coordination is the ability to jointly and efficiently move different parts of the body, while agility can be defined as the ability to quickly change the direction and position.

Explanation:

What do you think are the most important things that make a cheer team successful?

Answers

Being successful on a team depends on your ability to relate to, comprehend, and read your teammates' feelings, reactions, and body language.

With leadership, it becomes much more crucial. When we are able to comprehend, sympathise with, and then assist that colleague in a way that will be best accepted.- Physical stamina: becoming a cheerleader requires a lot of physical effort. - Confidence: When speaking in front of an audience, they must exude confidence in both their team and themselves. - Teamwork: Cheerleading is about working together. - Discipline: Establishing routines is important. Every cheerleading talent requires a lot of strength.Being successful on a team depends on your ability to relate to, comprehend, and read your teammates' feelings, reactions, and body language.  Stunting makes it simpler to carry and hold fliers while also reducing the risk of harm. Although it is simple to ignore, endurance is equally important. The foundation, back spot, & flyer are the three primary cheerleading positions. Even though there are just three primary positions in cheer, numerous cheerleaders fill these roles during a routine.

Learn more about body

https://brainly.com/question/4468840

#SPJ4

When is it most appropriate to consider requesting additional ambulances at an accident scene?

Answers

When you determine there are multiple patients it is most appropriate to consider requesting additional ambulances at an accident scene.

An ambulance is a medically equipped vehicle that transports patients to treatment facilities, like hospitals. Typically, out-of-hospital medical aid is provided to the patient throughout the transport. Ambulances are accustomed answer medical emergencies by emergency medical services.

If somebody is injured in a happening, initial certify you and therefore the one who is injured don't seem to be in any danger. If you are, create true safe. once it's safe to try to to therefore, assess the one who is separated and, if necessary, dial 999 for an ambulance, so that the patient can be shifted to the medical care.

To learn more about ambulance here

brainly.com/question/11636128

#SPJ4

gym-basketball
When dribbling, you should keep your head up and use your fingers to control the ball
true or false

Tiffany just made a half court shot at the buzzer while getting fouled. Her team is down by 3 points, can she win the game for her team?

Answers

The answer would be false and True i work for dominion power

Answer:

true

Explanation:

if you look at the basketball players you will see they're head up and use they're hands/fingers to do it

What happens if I do planks everyday?

Answers

Exercises like planking help you stand more erect by building up your back, neck, chest, shoulder, and abdominal muscles. If you perform the plank every day, you'll notice an improvement in your posture and a straighter back.

Do planks reduce abdominal fat?

Planks are ideal for losing belly fat because they work numerous muscles at once, increasing metabolism and strengthening the core. Planking is a great choice overall for stimulating the entire body. Plank is an excellent exercise for the facilitating the entire body.

Can planks alone help you lose weight?

In actuality, performing only different types of planks will provide you a full-body exercise. The five different plank variations in the workout below target different parts of your body.

To know more about plank visit:-

https://brainly.com/question/29844823

#SPJ4

How many calories does a 1 minute plank burn?

Answers

it depends on who’s doing it

How can I feel confident before competition?

Answers

Positive thoughts and phrases will not make you more confident, but confident people believe a lot of good about themselves. Remind yourself of your abilities and what you've previously accomplished.

The self-talk is by far the most crucial secret to developing self-confidence. The most crucial thing, and I cannot emphasise this enough, is self-talk. Talk to yourself nicely, and treat yourself with love and respect. Unhappy childhood in which parents (or other major figures such as teachers) were harsh. Inadequate academic achievement at school leads to a lack of confidence. A continuing stressful life event, such as a relationship split or financial difficulty.

Learn more about to confident visit here;

https://brainly.com/question/13067956

#SPJ4

How should stomach be during plank?

Answers

During plank keep your stomach muscles tight, with all-time low of your ribs force in toward you. it is vital to carry this core position throughout the movement.

The plank strengthens your spine, your rhomboids and musculus trapezius, and your abdominal muscles, that naturally lead to a robust posture as they grow in strength. Developing your posture will improve on variety of ailments, and stop the onset of alternative ones. Sensible posture suggests that you are keeping your bones aligned.

So any movement that works your core goes to exercise over one muscle cluster. Planks conjointly facilitate develop strength within the shoulders, arms and glutes.

To learn more about core here

brainly.com/question/29797816

#SPJ4

How you think requiring nutrition labeling on foods has affected consumers?

Answers

According to researchers, food labels reduce consumer intake of calories by 6.6%, fat by 10.6% and other unhealthy food options by 13%. Labels also increase vegetable consumption by 13.5%.

What is nutrition labelling ?

The information on food labels is meant to educate people about the options available to them. The material on a package's front, back, and sides tells us what the item contains and offers suggestions for choosing processed foods that are healthier.

You may see several essential nutrients that have an effect on your health. You can use the label to support your individual dietary requirements, look for items that have higher concentrations of the nutrients you want to consume more of and lower concentrations of the ones you might want to limit. Less-needed nutrients include. Sodium, added sugars, and saturated fat

Learn more about Nutrition labelling here:

https://brainly.com/question/25713269

#SPJ4

Mrs. Thomas was on vacation out of state when she stepped off a curve and injured her left ankle. Due to severe pain she was seen at an urgent care center where she underwent a left ankle x-ray, which was negative. She was diagnosed with a left sprained ankle. A walking boot was provided to stabilize and protect her left ankle. She was provided with appropriate discharge instructions and instructed to follow up with her primary care physician upon returning home. When she presented her BlueCross BlueShield insurance card at check out, Mrs. Thomas was informed that the physician who provided treatment is a nonparticipating provider (nonPAR) and that the urgent care center accepts credit cards for payment in full. The total due was $1,500, and Mrs. Thomas assured the office staff that her insurance company would reimburse the urgent care center for services provided. The office staff further explained that their providers had not signed a contract with her insurance, and thus Mrs. Thomas was required to settle the bill upon discharge. The office staff suggested that her Blue Cross/Blue Shield insurance plan might reimburse Mrs. Thomas for the urgent care center encounter and that she would need to submit the invoice and claim to her insurance company. What are the requirements of a BCBS participating provider (PAR)?

Answers

BlueCross BlueShield (BCBS) participating providers, also known as PAR providers, are health care providers who have signed a contract with BCBS to provide services to BCBS members. This means that they agree to accept the reimbursement rates and terms specified in the contract with BCBS, and BCBS members will typically pay less out-of-pocket for services received from PAR providers. Non-PAR providers, on the other hand, have not signed a contract with BCBS and may not be required to accept the same reimbursement rates and terms. As a result, BCBS members may have to pay more out-of-pocket for services received from non-PAR providers. It is important for BCBS members to check with their insurance plan to determine which providers are PAR and which are non-PAR, as this can affect their out-of-pocket costs for services received.

What is one of the key ways to overcome the fear of making presentations?

Answers

Anxiety, lack of concentration, speaking too quickly, and negative thinking ("I can't do this," "They won't like me," "They won't like my presentation") are examples of psychological responses.

Public speaking anxiety is very frequent and normal. Even professional speakers experience nerves before a large presentation. Fear frequently emerges when people overestimate the stakes of conveying their thoughts in front of others, considering the speaking event as a potential threat to their credibility, image, and opportunity to reach an audience. Fear frequently emerges when people overestimate the stakes of conveying their thoughts in front of others, considering the speaking event as a potential threat to their credibility, image, and opportunity to reach an audience.

Learn more about to fear of making presentations visit here;

https://brainly.com/question/27427831

#SPJ4

How can I reverse glaucoma naturally?

Answers

ANSWER:

Eat a healthy diet. Eating a healthy diet can help you maintain your health, but it won't prevent glaucoma from worsening. ...

Exercise safely. Regular exercise may reduce eye pressure. ...

Limit your caffeine. ...

Sip fluids carefully. ...

Take prescribed medicine.

A loss of judgment
A. is the same as
B. is worse than
poor judgment.
C. is not the same as

Answers

Answer:

A

Explanation:

It is the sam as the poor judgment

Do sit-ups work your legs?

Answers

Sit-ups works muscles in the chest, back, and legs. Sit-ups are classical core exercises frequently used in exercise programs due to their simplicity and effectiveness.

Sit-ups are classic abdominal exercises done by lying on your back and elevating your torso. They employ your body weight to strengthen and tone the core- stabilizing abdominal muscles.

Sit-ups work the rectus abdominis, transverse abdominis, and obliques in addition to your hipsterism flexors, chest, and neck. They advance good posture by working your lower back and gluteal muscles.

With a larger range of stir, sit-ups target further muscles than crunches and static core exercises.

Core strength is one of the biggest motivators for doing sit-ups. By strengthening, tightening, and toning your core, you downgrade your threat of back pain and injuries.

Doing sit-ups may ameliorate the appearance of your abdominals and overall figure.

For more information on Sit-ups, visit :

https://brainly.com/question/29045431

#SPJ4

How long you should hold a plank pose to flatten the belly?

Answers

According to experts, you should aim to hold a plank for at least 60 seconds three times per week in order to reduce belly fat. Trainers claim that sticking to the routine of holding a plank for 60 seconds produces the best benefits.

Can you lose tummy fat by doing planks?

The best exercise for losing belly fat is planking since it works a range of muscles simultaneously, which increases metabolism and strengthens the core. All things considered, holding the plank position is a great choice to excite your entire body.

Does planking help you lose tummy fat?

Planks are the best exercise for burning belly fat because they stimulate a variety of muscles at once, boosting metabolism and fortifying the core. All things considered, maintaining a plank is a terrific decision to stimulate your entire body.

To know more about plank exercise visit:-

https://brainly.com/question/25510157

#SPJ4

How long should a beginner hold a plank?

Answers

Aim for a 20–30 second plank when you first begin. Spend a week doing this, and when you feel ready, try holding it for 40 to 50 seconds, then repeat and increase the duration.

What length should a novice plank?

The majority of specialists say that 10 to 30 seconds should be adequate.

Concentrate on performing numerous sets of shorter durations. As you improve, you can hold a plank for up to one or even two minutes, but don't hold it for any longer.

Do planks reduce abdominal fat?

Planks are ideal for losing belly fat because they work numerous muscles at once, increasing metabolism and strengthening the core. Overall, holding a plank is a great choice to energize your entire body.

To know more about  plank exercise visit:-

https://brainly.com/question/25510157

#SPJ4

women need ________% essential fat for reproductive system-related fat deposits.

Answers

women need 12% essential fat for reproductive system-related fat deposits.

Essential fat and storage fat make up the majority of the body's overall fat. The fat required to maintain normal physiological activities is referred to as essential fat.

Muscles, nerve cells, bone marrow, the heart, liver, and lungs are just a few examples of the tissues that contain essential fat. About 3% of men's total weight and 12% of women's total weight is made up of this necessary fat.

Because it includes sex-specific fat, such as breast tissue, and other sex-related fat deposits, the amount of essential fat is higher in women. The storage fat serves as an energy source for metabolism as well as an insulator to keep the body warm.

To learn more about fat.

https://brainly.com/question/24255543?referrer=searchResults

What is the point of laughter?

Answers

Laughter is a way to express joy, relieve stress, and strengthen social bonds. It can also help boost your immune system, reduce pain, and improve your mood.

What is the Immune system?

The immune system is the body’s natural defense system that helps protect it from disease and infection. It is made up of a network of cells, tissues, and organs that work together to identify and destroy harmful substances and organisms in the body. It also helps the body to recognize and remember pathogens, so it can respond quickly to future exposures.

Laughter is a universal human behavior that serves many purposes. It helps to reduce stress and tension, relieve pain, boost the immune system, and promote bonding and feelings of closeness between people. It can also be used to express joy, happiness, and amusement. Laughter is a way of expressing emotions, communicating, and connecting with others. It is a powerful tool for building relationships and spreading joy.

To know more about immune system,

https://brainly.com/question/15595309

#SPJ4

What figure of speech is being used in this sentence laughter is the best medicine?

Answers

Metaphor is being used in this sentence, 'laughter is the best medicine' as a figure of speech.

What is a Metaphor?

A metaphor is a figure of speech that describes a person, place, or thing in a way that isn't literally true, but helps paint a vivid picture for the reader. It is used to make a comparison between two things that are not normally thought of as being related.

What is Laughter?

Laughter is a natural response to certain stimuli, such as jokes or humorous situations. It is usually accompanied by a smile, and can also be used as a coping mechanism in difficult or stressful situations. Laughter is contagious and has many positive benefits, such as reducing stress hormones, strengthening the immune system, and releasing endorphins, which can improve mood.

To know more about Laughter,

https://brainly.com/question/958964

#SPJ4

What do you say to someone who is nervous?

Answers

If a concerned friend decides to confide in you, demonstrate your support. Validate their experience rather than dismiss it. Avoid giving counsel without first listening to your friend if you don't have an anxiety illness.

Tell them you're there for them, inquire about how you can assist them, and listen to what they have to say. Inform them that you believe they are suffering a panic attack and that you are available to help them. Encourage them to breathe slowly and deeply - doing anything structured or repetitive that they can focus on, such as counting out loud or asking them to watch while you gently move your arm up and down, can help.

Learn more about to anxiety illness visit here;

https://brainly.com/question/4413977

#SPJ4

What is the difference between cardiovascular fitness and physical fitness?

Answers

Cardiovascular exercise is, by definition, any exercise that puts the heart and vascular system under stress in order to improve the heart's capacity to pump blood and provide oxygen to the body's tissues.

Additionally, exercise aims to maintain or enhance physical fitness. Your cardiorespiratory fitness, commonly known as your CRF, tells a lot about your health and the likelihood of certain health outcomes. CRF assesses the efficiency with which your body absorbs oxygen and distributes it to your muscles and organs after extended activity. Regular exercise or cardiorespiratory fitness reduces the risk of dying from cardiovascular disease in general and coronary heart disease in particular.

Learn more about Cardiovascular here:

https://brainly.com/question/6943789

#SPJ4

2. All participants in the TBI/NHTD waiver
must have Independent Living Skills
Training Services.
O True
O False

Answers

Answer:

True

Explanation:

I remember learning this in the Principal of Health Class at school. Yes, most TBI waivers must have Independent Living Skills.

What causes lack of access to clean water?

Answers

Water pollution, excessive water use, increased water demand, climate changes, inadequate management of water resources, and poverty are only a few of the causes of a lack of clean water.

What are some factors that affect people's ability to acquire clean water?

Environments people live in have an impact on their access to clean water and proper sanitation. Money, education, and geographic location reliably predict access to sanitary facilities despite the wide range of conditions in different countries.

Is it difficult to have access to safe, hygienic drinking water?

However, the world's water resources are under jeopardy. A better water supply is still inaccessible to 780 million people, and 80% of our effluent is currently recycled without being treated.

To know more about lack of water visit:-

https://brainly.com/question/1152570

#SPJ4

Which vitamins are thought to be of particular importance in the prevention and treatment of bronchopulmonary dysplasia?
a. Pyridoxine, niacin, and folate
b. Vitamins A, C, and E
c. Folate, B12, and K
d. Thiamin, riboflavin, and vitamin D

Answers

Answer: B

Explanation:

Answer: B

Explanation: The antioxidant vitamins have been theorized to be beneficial in treating BPD because of their role in maintaining cell membrane integrity. Vitamin A has been reported as beneficial; however, insufficient evidence exists regarding vitamins C and E in relationship to their potential effects.

What is the most popular food for dinner?

Answers

Chicken Parm-Stuffed Spaghetti Squash. The most common however more common ones are as followed.

Explanation:

Chicken Piccata.

4-Ingredient Bacon Ranch Chicken Bake.

Creamy Lemon Butter Chicken.

One-Pan Balsamic Chicken and Veggies.  Chicken Fajitas.

Zucchini Chicken Alfredo.

Easy Butter Chicken

Who can write Dr with name?

Answers

A doctoral degree( PhD) is a degree that one earns after a master's degree. A PhD entitles a person to exercise the title doctor orDr.

Doctor is an academic title that originates from the Latin word of the identical spelling and meaning. The word is originally an agentive noun of the Latin verb docēre that means' to educate'. It has been recruited as an academic title in Europe since the 13th century, when the first doctorates were awarded at the University of Bologna and the University of Paris.

Having come established in European universities, this operation circulate around the world. Contracted" Dr" or"Dr.", it's used as a designation for a person who has achieved a doctorate( typically a PhD/ DPhil). In multitudinous parts of the world it's also used by medical practitioners, regardless of whether they hold a doctoral- position degree.

For more information on doctoral degree (PhD), visit :

https://brainly.com/question/28014445

#SPJ4

How do you know if nutritional information is reliable?

Answers

Registered dietitians or specialists with advanced degrees in nutrition are the most trustworthy sources of dietary advice. You can contact any dietitian to check the reliability of the nutritional information.

How to check nutritional information on food items?

In many nations, the majority of packaged foods must have a nutrition information label that lists the food's nutrients and other ingredients. Labels typically follow established nutritional grading scales. The majority of nations also publish comprehensive nutrition recommendations for general educational purposes.

According to the given question:

These are the six methods for determining whether or not a piece of nutrition information is trustworthy:

1) The author is a Registered Dietitian (RD) or Professional Dietitian (PDt);

2) The article has been peer reviewed;

3) The article lists sources of information;

4) The article does not promote one or more products;

5) The claims in the article do not appear to be "too good to be true";

6) The article does not contain any grammatical errors.

Learn more about Nutrition here:

brainly.com/question/1553515

#SPJ4

What are the causes of juice spoilage?

Answers

Fruit juices are spoiled primarily due to proliferation of acid tolerant and osmophilic microflora. There is also risk of food borne microbial infections which is associated with the consumption of fruit juices.

What causes bacterial infections?

A bacterial infection occurs when bacteria enter the body, increase in number, and cause a reaction in the body. Bacteria can enter the body through an opening in your skin, such as a cut or a surgical wound, or through your airway and cause infections like bacterial pneumonia

What are three common bacterial infections?

Family physicians frequently treat bacterial skin infections in the office and in the hospital. Common skin infections include cellulitis, erysipelas, impetigo, folliculitis, and furuncles and carbuncles.

To know more about microbial infections visit:

https://brainly.com/question/3311633

#SPJ4

How do you get rid of hanging belly?

Answers

having a better nutrition, losing weight and doing abdomen related exercises

What is the importance of self assessment of your muscular strength and muscular endurance to your health?

Answers

There are numerous reasons why muscular strength and endurance are crucial: increase the endurance with which you can carry out tasks like opening doors, lifting boxes, or chopping wood.

lessen the chance of damage. assist you in maintaining a healthy weight.

Two crucial components of your body's capacity to move, lift objects, and perform daily activities are muscular strength and endurance. The force you can exert or the weight you can lift is a measure of your muscular strength. How many times you can lift that weight before becoming exhausted is a measure of muscular endurance (very tired).

Benefits of Physical Endurance and Strength

There are numerous reasons why muscular strength and endurance are crucial:

increase the endurance with which you can carry out tasks like opening doors, lifting boxes, or chopping wood.lessen the chance of damage.assist you in maintaining a healthy weight.lead to stronger, healthier bones and muscles.Gain self-assurance and feel better about yourself.give you a feeling of achievement.Permit you to diversify and add new exercises to your routine.

Learn more about " muscular endurance " to visit here;

https://brainly.com/question/1310196

#SPJ4

Other Questions
What theorem is being applied if two triangles of one triangle are congruent to two angles of another triangle and the triangles are similar? Which details develop the central idea that the leaders believe? which system supports sales forecasting? a. personnel information systems b. marketing information systems c. financial information systems d. logistics information systems A playground is in the shape of a rectangle. The length of the rectangle is three times its width. The area of the playground is 19,500 square feet. What is the length of the playground? Round to the nearest foot. Hint: use A=LW Please write in the correct adjective.1. Mi hermano es __________(fat).2. Mis abuelos son _______(strong). 3. La hija es muy _______ (pretty).4. Mi esposo y yo somos ___________ (smart).5. Yo soy ______________ (burnette).6. Yo estoy ____________(busy).7. Nosotras estamos __________(sad). In the figure below, R is between Q and S, and S is between R and T. If QS = 12, RT=9, and QT=17, find RS. Name the main layers of a tropical rain forest. What kinds of plants grow in eachlayer? Please select the word from the list that best fits the definitionIllegitimate power that is achieved by force or the threat of force. Describe and correct the error in solving the equation This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI