Write two expressions that are equivalent to 3 . 10^-6

Answers

Answer 1

Answer:

636372

Step-by-step explanation:

the answer is 636372


Related Questions

A bicycle tire is 28 inches in diameter how far does the bicycle move forward each time the wheel goes around use 22/7 as an approximately for π

Answers

Answer:

88 inches

Step-by-step explanation:

Well the bike will travel the distance of the circumference of the tire.

Circumference is 2*pi*radius or pi*diameter since the diameter is twice the radius

I guess they want is to use 22/7 for pi, which is weird, but whatever.

C = pi*d

C = 22/7*28

This gets you [tex]C = \frac{616}{7}[/tex] or 88 inches

20 POINTS HELPIf these two rectangles are similar, what is the measure of the missing length d ?

Answers

Answer:

d (or V in the picture) = 16

Step-by-step explanation:

Because the two triangle are similar, the ratios of each of the side lengths should be equal.  Therefore, 8/1 should be equal to d/2.

1.) Set up equality of ratios: 8/1 = d/2

2.) Cross multiply: 8*2 = d*1

3.) 16 = d

As an estimation we are told £3 is €4.
Convert £40.50 to euros.

Answers

Answer:

As per the conversion in the question, £40.50 = €54

Step-by-step explanation:

Here, we want to make a conversion;

from the question;

£3 = €4

£40.50 = €x

Thus;

3 * x = 4 * 40.5

x = (4 * 40.5)/3

x = €54

2 qt 1 cup = ___ fl oz

A. 40
B. 72
C. 80
D. 136

Answers

It should be C you’re welcome

Answer:

80 fl oz

2qts = 8 cups

Find the volume V of the solid obtained by rotating the region bounded by the given curves about the specified line.
y = 5x^3, y = 5x, x ≥ 0; about the x-axis
V=?
Sketch the region.
Sketch the solid, and a typical disk or washer.

Answers

The volume (V) of the solid obtained by rotating the region bounded by the curves y = 5x^3, y = 5x, x ≥ 0 about the x-axis is V = ∫[0,1] 2πx((5x) - (5x^3))dx.

To find the volume of the solid, we can use the method of cylindrical shells. We will integrate the volume of each shell as it rotates around the x-axis.

First, let's sketch the region bounded by the curves. The curve y = 5x^3 intersects with the line y = 5x at two points: (0, 0) and (1, 5). The region between these curves is bounded by the x-axis and the curves. It looks like a "bowl" shape, opening upwards, with the bottom touching the x-axis.

Next, let's visualize a typical cylindrical shell. Imagine taking a thin strip of thickness Δx at a distance x from the x-axis. When this strip rotates around the x-axis, it forms a cylindrical shell. The height of this shell is the difference between the two curves: (5x) - (5x^3). The circumference of the shell is 2πx since it is the distance around the axis of rotation. The thickness of the shell is Δx.

The volume of the shell is given by V_shell = 2πx((5x) - (5x^3))Δx. To find the total volume, we need to sum up all these shells by integrating with respect to x.

Integrating V_shell from x = 0 to x = 1, we get V = ∫[0,1] 2πx((5x) - (5x^3))dx.

Evaluating this integral will give us the volume of the solid obtained by rotating the region about the x-axis.

Learn more about volume here

https://brainly.com/question/27710307

#SPJ11

100 POINTS!!!!
An expression is shown below:

f(x) = 2x2 − 5x + 3

Part A: What are the x-intercepts of the graph of f(x)? Show your work. (2 points)

Part B: Is the vertex of the graph of f(x) going to be a maximum or minimum? What are the coordinates of the vertex? Justify your answers and show your work. (3 points)

Part C: What are the steps you would use to graph f(x)? Justify that you can use the answers obtained in Part A and Part B to draw the graph. (5 points)

Answers

Answer:

Part A: In order to find the x-intercepts, you should set f(x)=0. Then, .  and .

Part B: From the function, it is visible that it is going to be a minimum, because the function is cup-size. Vertex coordinates can be calculated by the formula . Then  and . The vertex coordinates are (-1.25, -0.125)

Part C: By using the vertex coordinates, we can construct the vertex of the function and then using the information about the x-intercept we can complete the function. The function looks like in the picture below.

Step-by-step explanation:

Help me pls I give points

Answers

Answer:

c=14.87

Step-by-step explanation:

use pythagorean theroem

10^2 + 11^2 =c^2

solve

100+121=c^2

c^2=221

c=14.87(rounded to nearest hundredths )

The fixed costs for a company are $1,596.00 per month, and their variable cost per unit is $3.20. Suppose the company insists on producing 140 units, the selling price per unit required to break even is $

Answers

When the company insists on producing 140 units then the selling price per unit required to break even is approximately $14.60.

To calculate the selling price per unit required to break even, we need to consider the fixed costs, variable cost per unit, and the desired production quantity.

Given:

Fixed costs = $1,596.00 per month

Variable cost per unit = $3.20

Production quantity = 140 units

To break even, the total revenue should cover both the fixed costs and the variable costs.

The total cost can be calculated as follows:

Total cost = Fixed costs + (Variable cost per unit × Production quantity)

Plugging in the given values:

Total cost = $1,596.00 + ($3.20 × 140)

Total cost = $1,596.00 + $448.00

Total cost = $2,044.00

To break even, the total revenue should be equal to the total cost.

The selling price per unit required to break even can be calculated as:

Selling price per unit = Total cost / Production quantity

Plugging in the values:

Selling price per unit = $2,044.00 / 140

Selling price per unit ≈ $14.60

Therefore, the selling price per unit required to break even is approximately $14.60.

Learn more about total revenue here:

https://brainly.com/question/30760779

#SPJ11

Which of the following are characteristics of a tortoise in a desert environment that distinguish the tortoise as a living thing?
Choose the THREE that apply.
A. It needs food.
B. It reproduces.
C. It uses energy.
D. It takes up space.
E. It is made up of atoms.

Answers

Answer:

A.

B.

E.

Step-by-step explanation:

hope this helps ❤️

Answer
B.
A.
E.
It’s not c because there are many things that can contain energy

Find any vertical or slant asymptotes. Consider the following.

f(x) = x^3/ (x² - 49)

Answers

The function  [tex]f(x) = x^3 / (x^2 - 49)[/tex]has a vertical asymptote at x = 7 and x = -7. There are no slant asymptotes. To find the vertical asymptotes of the function f(x), we need to identify the values of x for which the denominator becomes zero, as division by zero is undefined.

In this case, the denominator is (x² - 49). To determine when it equals zero, we set it equal to zero and solve for x:

x² - 49 = 0

This equation can be factored as the difference of squares:

(x - 7)(x + 7) = 0

Setting each factor equal to zero, we find that x = 7 and x = -7. Therefore, the function has vertical asymptotes at x = 7 and x = -7.

On the other hand, to determine if there are any slant asymptotes, we need to check if the degree of the numerator (x³) is greater than the degree of the denominator [tex](x^2 - 49)[/tex]. In this case, the degree of the numerator is 3, while the degree of the denominator is 2. Since the degree of the numerator is greater, there are no slant asymptotes for this function.

In summary, the function [tex]f(x) = x^3 / (x^2 - 49)[/tex] has vertical asymptotes at x = 7 and x = -7. There are no slant asymptotes.

Learn more about denominator here: https://brainly.com/question/15007690

#SPJ11

Let C be a closed contour and let zo ∈ C be a point not lying on C. The winding number of C about zo is defined by the integral.

n(C,zo) = 1/2πi ∫ 1/(z-zo)dz.

Answers

The winding number of a closed contour C about a point zo is defined as the integral of the function 1/(z - zo) over the contour C, divided by 2πi.

The winding number, denoted as n(C, zo), measures how many times the contour C wraps around the point zo in the counterclockwise direction. It is a topological property of the contour and is an integer value.

To calculate the winding number, we evaluate the integral 1/(z - zo)dz along the contour C. The contour must be positively oriented (counterclockwise) and enclose the point zo. The integral measures the net change in the argument of the complex number z - zo as we traverse the contour.

The value of the integral divided by 2πi gives us the winding number, which represents the number of times the contour wraps around the point zo in the counterclockwise direction.

To learn more about integer value, click here: brainly.com/question/30697860

#SPJ11

what is the ratio of the length of red string to blue string written as a unit rate

Answers

Answer:2 to 3

Step-by-step explanation:

Answer:

Step-by-step explanation:

-23 = x - 23
A. Infinite number of solutions
B. No solution
C. 0
D. 5

Answers

Answer:

x=0

Step-by-step explanation:

have a nice day or evening

Solve the differential equation = -xy, given that when x=0, y=50. You may assume y>0. (4 marks) dx (b) For what values of x is y decreasing?

Answers

The solution to the differential equation is [tex]y = e^{-\frac{x^2}{2} + \ln(50)}[/tex]

The value of y is decreasing for x > 0.

Solving the differential equation

From the question, we have the following parameters that can be used in our computation:

dy/dx = -xy

Rewrite as

dy/y = -x dx

Differentiate both sides

So, we have

ln|y| = -x²/2 + c

Take the exponent of both sides

[tex]|y| = e^{-\frac{x^2}{2} + c}[/tex]

Assume y > 0

So, we have

[tex]y = e^{-\frac{x^2}{2} + c}[/tex]

When x = 0, y = 50

So, we have

[tex]50 = e^{-\frac{0^2}{2} + c}[/tex]

Evaluate

c = ln(50)

So, we have

[tex]y = e^{-\frac{x^2}{2} + \ln(50)}[/tex]

For what values of x is y decreasing?

Recall that dy/dx = -xy.

This means that if dy/dx < 0, then y is decreasing.

This means that, y is decreasing for x > 0.

Read more about differential equation at

https://brainly.com/question/1164377

#SPJ4

Approximately 9% of all people are left-handed. Consider 27 randomly selected people. a) State the random variable. rv X = the number of 27 randomly selected people that are left-handed b) List the given numeric values with the correct symbols. nV = 27 p = 0.09 c) Compute the mean. Round final answer to 2 decimal places. Which of the following is the correct interpretation of the mean? Out of every 27 people, 2.43 of them on average are left-handed d) Compute the standard deviation. Round final answer to 2 decimal places.

Answers

a) The random variable is X, which represents the number of 27 randomly selected people that are left-handed.

b) Given values: n = 27  p = 0.09

c)  The correct interpretation of the mean is: Out of every 27 people, on average, 2.43 of them are left-handed.

d) The standard deviation is approximately 1.49

a) The random variable is X, which represents the number of 27 randomly selected people that are left-handed.

b) Given values:

n = 27 (sample size)

p = 0.09 (probability of a person being left-handed)

c) To compute the mean, you can multiply the sample size by the probability:

Mean (μ) = n * p

μ = 27 * 0.09 = 2.43

The correct interpretation of the mean is:

Out of every 27 people, on average, 2.43 of them are left-handed.

d) To compute the standard deviation (σ), you can use the formula for the binomial distribution:

Standard Deviation (σ) = √(n * p * (1 - p))

σ = √(27 * 0.09 * (1 - 0.09))

σ = √(2.43 * 0.91)

σ ≈ √2.2153

σ ≈ 1.49 (rounded to 2 decimal places)

Therefore, the standard deviation is approximately 1.49

To learn more about random variable

https://brainly.com/question/17481850

#SPJ11

What is the volume of a box with 385 cubes and 11/3 x 5/3 x 7/3

Answers

Answer:

y

=

x

2

2

x

,  

y

=

x

Step-by-step explanation:

What is the measure of the other acute angle ?

Answers

Answer:

58

Step-by-step explanation:

Answer: 58°

Step-by-step explanation:

We know it's a right triangle, one of them must be 90°. The sum of the three interior angles are 180°, so we know the sum of the other two angles is 180 - 90 = 90°.

If one of the angles is 32°, another angle is 90 - 32 = 58°

Which sentence is TRUE!!!!!!

Answers

The answer would be D

Type the correct answer in each box. Use numerals instead of words. If necessary, use / for the fraction bar(s).
Consider the quadratic expression below.

Answers

Answer:

x = -3 and x = 2

Step-by-step explanation:

The expression for the quadratic equation is as follows:

(x+3)(x-2)

For (x+3)(x-2) to equal 0, either (x+3) or (x-2) must be equal to 0. So,

(x+3) = 0 and (x-2) = 0

It implies,

x = -3 and x = 2

So, the values of x are -3 and 2.

Can someone plz help this is my third time posting this question and I’m trying to get an 92

Answers

21 is the right answer.

180-138=42°

and since it is given in the question that the triangle is isoceles ,so half of 42 is 21°

Answer:

the last three answers is what i think

Step-by-step explanation:

Carlos rode his bike 1 2/3 miles to Tim's house then 1 2/3 to the park. What number line shows u the total number of miles that Carlos rode from house to the park

Answers

Number line wasn't added to the original question

Answer:

Carlos rode his bike 1 2/3 miles to Tim's house then 1 2/3 to the park. What number line shows u the total number of miles that Carlos rode from house to the park

Step-by-step explanation:

Distance biked to Tim's house = 1 2/3 miles

Distance biked to park = 1 2/3 miles

Total number of miles Carlos rode from house to park :

1 2/3 + 1 2/3

5/3 + 5/3

(5 + 5) / 3

10 /3

= 3 1/3 miles

Find the Laurent series of the function cos z, centered at z = 플 1

Answers

The Laurent series of cos z centered at z = 1 is: cos(z - 1) = ∑((-1)^n * ((2n C k) * z^(2n - k)))/(2n)!

To obtain the Laurent series of the function cos z centered at z = 1, we can use the known Maclaurin series expansion of the cosine function and then adjust it for the center of expansion.

The Maclaurin series expansion of cos z is given by:

cos z = ∑((-1)^n * z^(2n))/(2n)!

To center the expansion at z = 1, we can substitute z - 1 for z in the series:

cos(z - 1) = ∑((-1)^n * (z - 1)^(2n))/(2n)!

Expanding this expression using the binomial theorem, we have:

cos(z - 1) = ∑((-1)^n * ((-1)^n * (2n C k) * z^(2n - k)))/(2n)!

Simplifying further, we obtain:

cos(z - 1) = ∑((-1)^n * ((2n C k) * z^(2n - k)))/(2n)!

To know more about Laurent series refer here:

https://brainly.com/question/32273131#

#SPJ11

The probability of spinning a 9 on Luke's game spinner is . The probability of rolling a 6 on a fair
die is Which shows the probability of spinning a 9 and then rolling a number that is NOT a 6?

Answers

Answer:

First, there are  

3

numbers (6, 7, 8) greater than  

5

on a spinner numbered  

1

-

8

(1, 2, 3, 4, 5, 6, 7, 8). Therefore, there is a:

3

8

probability of spinning a number greater than  

5

.

However, there is only a 50-50 or  

1

2

chance of tossing a tail on a coin.

Therefore the probability of spinning a number greater than  

5

AND tossing a tail is:

3

8

×

1

2

=

3

16

Or

3

in  

16

Or

18.75%

Step-by-step explanation:

The following differential equation describes the movement of a body with a mass of 1 kg in a mass-spring system, where y(t) is the vertical position of the body in meters) at time t. y" + 4y + 5y = -21 To determine the position of the body at time t complete the following steps. (a) Write down and solve the characteristic (auxiliary) equation. (b) Determine the complementary solution, yc, to the corresponding homogeneous equation, y" + 4y' + 5y = 0. (c) Find a particular solution, Yp, to the nonhomogeneous differential equation, Y" + 4y' + 5y = e-21. Hence state the general solution to the nonhomogeneous equation as y = Ye + yp. (d) Solve the initial value problem if the initial position of the body is 1 m and its initial velocity is zero.

Answers

After considering the given data we conclude that
a) r = -2 + i and r = -2 - i value generated after solving the auxiliary equation
b)[tex]y_c = c_1e^{(-2t)} cos(t) + c_2e^{(-2t)} sin(t)[/tex] complementary solution
c) general solution to the nonhomogeneous equation is [tex]y = y_c + Y_p = c_1e^{(-2t)} cos(t) + c_2e^{(-2t)} sin(t) + (1/26)e^{(-21)} .[/tex]
d) initial value problem is [tex]y(t) = e^{(-2t)} (cos(t) + 2sin(t))/2 + (1/26)e^{(-21)} .[/tex]

To determine the position of the body at time t, we can apply the given differential equation to solve for y(t). To do this, we can follow the steps below:
(a) the characteristic (auxiliary) equation is
The characteristic equation is obtained by setting the coefficients of the differential equation to zero, which gives us the equation  [tex]r^2 + 4r + 5 = 0.[/tex]Solving this quadratic equation, we get r = -2 + i and r = -2 - i.
(b) evaluate the complementary solution, yc, to the corresponding homogeneous equation, [tex]y" + 4y' + 5y = 0.[/tex]
The complementary solution is given by[tex]y_c = c_1e^{(-2t)} cos(t) + c_2e^{(-2t)} sin(t),[/tex]where [tex]c_1[/tex] and [tex]c_2[/tex] are constants determined by the initial conditions.
(c) Calculate a particular solution, Yp, to the nonhomogeneous differential equation, [tex]Y" + 4y' + 5y = e^{(-21)}[/tex]. Hence state the general solution to the nonhomogeneous equation as [tex]y = y_c + y_p.[/tex]
To describe a particular solution, we can use the method of undetermined coefficients and guess a solution of the form [tex]Yp = Ae^{(-21)}[/tex], where A is a constant to be determined.
Staging this into the differential equation, we get A = 1/26. Therefore, the particular solution is [tex]Y_p = (1/26)e^{(-21)}[/tex]. The general solution to the nonhomogeneous equation is [tex]y = y_c + Y_p = c_1e^{(-2t)} cos(t) + c_2e^{(-2t)} sin(t) + (1/26)e^{(-21)}[/tex]
(d) Solve the initial value problem if the initial position of the body is 1 m and its initial velocity is zero.
Applying the initial conditions, we can solve for the constants [tex]c_1[/tex] and [tex]c_2[/tex] in the complementary solution. Since the initial velocity is zero, we have [tex]y'(0) = -2c_1 + c_2 = 0[/tex], which gives us [tex]c_2 = 2c_1.[/tex]
Applying the initial position, we have [tex]y(0) = c_1 = 1[/tex], which gives us [tex]c_2 = 2.[/tex]Therefore, the solution to the initial value problem is [tex]y(t) = e^{(-2t)} (cos(t) + 2sin(t))/2 + (1/26)e^{(-21)}[/tex]
To learn more about differential equation
https://brainly.com/question/28099315
#SPJ4

HELP FAST No DECIMAL plz!

Answers

Answer: 1,145,375 centimeters cubed

Step-by-step explanation:

Answer: 1,145,375cm I think

Step-by-step explanation:

how resolve it
plssss​

Answers

Answer:

The answer is a

Step-by-step explanation:

A person walks 1/5 mile in 1/15 of an hour.
They are going what miles an hour?

Answers

Answer:

(1/5 mi) / (1/15 hr) = 1/5 * 15/1 = 3 mi/hr

hope this helps

Step-by-step explanation:

1.13 UNIT TEST GRAPH OF SINUSOIDAL FUNCTION PART 1

Answers

The true statements from the sinusoidal graph are:

The maximum height of the Ferris wheel is 64 ftThe radius of the Ferris wheel is 30 ft

From the table, we have the following parameters:

Maximum height = 64 ftMinimum height = 4 ft

So, the radius (r) of the wheel is:

[tex]r = \frac{64 - 4}{2}[/tex]

This gives

[tex]r = \frac{60}{2}[/tex]

[tex]r = 30[/tex]

Also, from the table, the lowest point of the wheel is 4 ft;

The Ferris wheel is at this lowest point at 7.5 seconds and 17.5 seconds

Hence, the true statement is (c) and (d)

Read more about sinusoidal functions at:

https://brainly.com/question/2410297

3. For each function, determine whether it is even, odd, or neither. Explain

a&b in photo
c. The function given by = 3 − 4

Answers

The function is not symmetric about the y-axis or the origin, which is consistent with the conclusion that it is neither odd nor even. A function can be categorized as odd, even or neither depending on its symmetry about the y-axis and the origin of the graph.

To determine whether a function is odd, even or neither, we need to check whether the function satisfies the following conditions:If f(-x) = f(x), then the function is evenIf f(-x) = -f(x), then the function is oddIf f(-x) ≠ f(x) and f(-x) ≠ -f(x), then the function is neither.

Now let's evaluate whether the given function f(x) = 3 − 4|x| is even, odd or neither. Evaluating f(-x) and f(x) :f(-x) = 3 - 4|(-x)|f(-x) = 3 + 4|x|Comparing the value of f(-x) and f(x) :f(-x) ≠ f(x) and f(-x) ≠ -f(x).

Therefore, the given function is neither odd nor even.Here is the graph of the function. We can see that the function is not symmetric about the y-axis or the origin, which is consistent with the conclusion that it is neither odd nor even.

For more question on graph

https://brainly.com/question/19040584

#SPJ8

find the missing angle measurement

Answers

Answer: 56

Step-by-step explanation: According to AIA(Alternate Interior Angles Congruency) they are equal. So just solve the equation that they're both equal to each other and you get x=-6. Plug this back in to find the angle measure, 56! Hope this helped!

Answer:

x = -6

56 degrees

Step-by-step explanation:

Those two angles that are labeled are equal for a reason that I forgot (but trust me they are). So, -8x+8 = -6x+20

just solve the equation to get x = -6

after plugging in -6 for x, you get that the angles that are labeled are 56 degrees.

Other Questions
Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy.