You are given two pairs of triangles. For the first pair of triangles, each side and angle of one triangle is congruent to the corresponding side and angle of the other. You show that rigid motions can transform one triangle so that it matches up with the other. For the second pair of triangles, you show that rigid motions can transform one triangle so that each angle or side of one triangle matches exactly with a corresponding angle or side of the other triangle. What have you proved?

Answers

Answer 1

Options:

a) If corresponding pairs of sides and corresponding pairs of angles of two triangles are congruent, then the triangles can be matched up exactly using rigid motions.

b) If two triangles can be matched up exactly using rigid motions, then the corresponding pairs of sides and corresponding pairs of angles of the triangles are congruent.

c) Two triangles can be matched up exactly using rigid motions if and only if corresponding pairs of sides and corresponding pairs of angles are congruent.

d) If corresponding pairs of sides and corresponding pairs of angles of two triangles are not congruent, then the triangles are not congruent.

Answer:

c) Two triangles can be matched up exactly using rigid motions if and only if corresponding pairs of sides and corresponding pairs of angles are congruent.

Step-by-step explanation:

For both pairs of triangles, what you proved is how to use rigid motions (i.e. rigid transformations) to make congruent shapes.

When rigid transformation is applied to a shape, the image (i.e. result) of the  transformation produces an exact shape (i.e. equal corresponding angles and corresponding sides), meaning that the side lengths and the angles of the preimage (before transformation) and the image (after transformation) is unaltered.

Option (c) is true


Related Questions

The regions of a country with the six lowest rates of violent crime last year are shown below.

1. Southern

2. Northeast

3. Southwest

4. Northern

5. Southeast

6. Eastern

Determine whether the data are qualitative or quantitative and identify the dataset's level of measurement.

Answers

The data provided, representing the regions of a country with the six lowest rates of violent crime, is qualitative in nature. The dataset's level of measurement can be classified as nominal.

The data is qualitative because it consists of categorical information describing the regions of a country. Qualitative data is non-numerical and represents qualities or attributes. In this case, the data categorizes the regions based on their geographical locations.

Moving on to the level of measurement, the dataset is at a nominal level. Nominal measurement involves classifying data into distinct categories without any inherent numerical or ordinal value. The regions listed (Southern, Northeast, Southwest, Northern, Southeast, and Eastern) are discrete categories with no specific order or ranking associated with them.

The ordering of the regions (from 1 to 6) is merely for reference and does not imply any quantitative relationship or numerical value. Therefore, the data remains at a nominal level of measurement, where categories are distinguished without any numerical or ordinal significance.

Know more about the dataset click here:

https://brainly.com/question/32536760

#SPJ11

Addition and subtraction of vectors: Velocities are vectors, we can add subtract velocities: [5A] a). An airplane flies with a velocity 400km/h towards North, it encounters a wind blowing from the West with velocity of 50 km/h, what is the resulting velocity of the airplane

Answers

Answer:

  403 km/h 7° east of north

Step-by-step explanation:

You want the resultant velocity of a plane flying 400 km/h north in a wind blowing 50 km/h to the east.

Vector sum

The attached calculator display shows the sum of the vectors ...

  400∠0° + 50∠90° ≈ 403∠7°

Angles here are heading angles, measured clockwise from north.

The velocity of the airplane is 403 km/h about 7° east of north.

__

Additional comment

When angles are specified this way, the calculator provides rectangular coordinates as (north, east). The internal representation of the vectors is as complex numbers with components (north + i·east). This representation is convenient for adding and subtracting vectors, and for finding bearing angles and the angles between vectors.

<95141404393>

Let Y represent the profit (or loss) for a certain company X years after 1965. Based on the data shown below, a statistician calculates a linear model Y = -2.28 X + 41.86.
х y
3 35
4 32.57
5 31.24
6 27.71
7 25.88
8 22.55
9 22.72
10 18.39
11 16.66
12 14.03
13 12.7
Use the model to estimate the profit in 1975
y = _____________

Answers

The estimated profit in 1975 was $19.06.

The given linear model is Y = -2.28 X + 41.86, which shows a linear relationship between the number of years after 1965 and the profit of a company in terms of y.

In order to estimate the profit in 1975, we need to determine the value of Y when X = 10 (since we are looking for the profit in 1975 which is 10 years after 1965).

We plug X = 10 into the equation Y = -2.28 X + 41.86 to find the estimated profit:

Y = -2.28 (10) + 41.86Y = -22.8 + 41.86Y = 19.06

Therefore, the estimated profit in 1975 was $19.06.

Learn more about estimated profit here:

https://brainly.com/question/4177260

#SPJ11

it costs $25 to enter an amusement park and $0.25 to ride a ride. you have $26. write an equation that represents the number r of rides you can ride. an equation is =26.

Answers

The equation that represents the number of rides you can ride is 0.25r + 25 = 26.

Let's denote the number of rides as "r". Since it costs $0.25 to ride each ride, the total cost of the rides will be 0.25r. Additionally, there is a fixed cost of $25 to enter the amusement park. Therefore, the equation representing the total cost is:

0.25r + 25 = 26

This equation states that the sum of the cost of the rides (0.25r) and the entrance fee ($25) equals the total amount you have ($26).

In this scenario, the equation 0.25r + 25 = 26 represents the cost of entering an amusement park and riding a certain number of rides. The term 0.25r signifies the cost of the rides, where "r" represents the number of rides. The fixed cost of $25 is added to the cost of the rides.

The equation states that the sum of these costs equals the total amount available, which is $26. By solving this equation, one can determine the maximum number of rides they can afford given their budget.

Learn more about equation https://brainly.com/question/29174899

#SPJ11

The worldwide market share for a web browser was 20.5% in a recent month. Suppose that a sample of 200 random students at a certain university finds that 50 use the browser
At the 0.05 level of significance is there evidence that the market share for the web browser at the university is greater than the worldwide market share of 20.5% ?
Determine the null and alternative hypotheses
A H_o :p≠0.205, H_a : p=0.205
B H_o :p=0.205, H_a : p>0.205
C H_o :p=0.205, H_a : p<0.205
D H_o :p=0.205, H_a : p≠0.205
Calculate the best statistic
Test Statistic = _____Type an integer or a decimal Round to two decimal places as needed)
What is the p-value?
The p-value is ______(Type an integer or a decimal Round to three decimal places as needed.)
State the conclusion of the best
______the null hypothesis. There is ______evidence to conclude that the market share at the university is ______ the worldwide market share of 20.5% .

Answers

The answers to the above prompt are given as follows

The null and alternative hypotheses

B. H_o :p=0.205,  H_a : p>0.205

the test statistic is 2.58

The p-value is 0.0094Conclusion of the test

The null hypothesis is rejected.

What is the explanation for the above?


1) The correct answer is B. H o :p=0.205, H_a : p  >0.205

2 The null hypothesis is that the market share for the web browser at the university is equal to the worldwide market share of 20.5%.

The alternative hypothesis is that the market share is greater than 20.5%.

3) The test statistic is calculated as follows.

z = (pa - p₀) /  √ (p₀(1-p₀) /n)

Where

* pa is the sample proportion of students who use the browser (  50/200= 0.25)

* p₀ is the hypothesized proportion of students who use the browser (0.205)

* n is the sample size (200)

The z-test statistic is 2.58.

4) The p-value is calculated as follows

p -value = P (Z > 2.58)

The p-value is   0.0094.

Since the p-value is less than the significance level of 0.05,we reject the null hypothesis   and conclude that there is sufficient evidence to suggest that the market share for the web browser at the university is greater than 20.5%.

Learn more about alternate hypothesis:
https://brainly.com/question/13045159
#SPJ4

This is 9t grade math. ddhbhb

Answers

The range and domain of the given graph are expressed as:

D = -4 ≤ x ≤ 3

R = -4 ≤ y ≤ 3

What is the domain and range of the graph?

The domain of a function is defined as the set of values that we are allowed to plug into our function. This set is the x values in a function such as f(x).

The range of a function is defined as the set of values that the function assumes. This set is the values that the function shoots out after we plug an x value in.

Now, since domain is set of input values and range is a set of output values, then from the graph, we can see that the domain is:

D = -4 ≤ x ≤ 3

Then the range is expressed as:

R = -4 ≤ y ≤ 3

Read more about Domain and Range at: https://brainly.com/question/2264373

#SPJ1

what kind of regular polygons can be used for regular tessellations

Answers

3 Answers:  

Equilateral trianglesSquaresRegular Hexagons

==============================================

Reason:

The interior angle formula of a regular polygon is

i = 180*(n-2)/n

where n = number of sides, and i = interior angle in degrees.

If n = 3, then each interior angle would be i = 60. Note how this interior angle is a factor of 360. This explains why equilateral triangles are a type of regular polygon that tessellates the plane.

If n = 4, then i = 90 which is also a factor of 360. This means squares are another type of regular polygon that tessellate the plane.

Unfortunately n = 5 leads to i = 108 which is not a factor of 360; therefore, regular pentagons do not tessellate the plane.

Luckily, n = 6 works because i = 120 is a factor of 360.

Any larger value of n will lead to some value of i that isn't a multiple of 360. Therefore, only equilateral triangles, squares, and regular hexagons are the only regular polygons that tessellate the plane.

∀x∃!y, Enrolled(x, y), where x is a student at Champlain College and y is a degree

A) All Champlain College Students are enrolled in at least one degree

B) All Champlain College Students are enrolled in exactly one degree

C) All degrees have at least one Champlain College student enrolled in it

D) All degrees have at least one Champlain College student enrolled in it

E) None of the alternatives is correct

Answers

The correct option is (B) All Champlain College Students are enrolled in exactly one degree.

The expression ∀x∃!y, Enrolled(x, y) where x is a student at Champlain College and y is a degree stands for all Champlain College students are enrolled in exactly one degree. Therefore, the correct answer is option B) All Champlain College Students are enrolled in exactly one degree.What is Champlain College?Champlain College is a private college that was founded in 1878, located in Burlington, Vermont, the United States of America. Champlain College has a small population of approximately 3,000 students. The college's main campus is situated on the hill above Burlington and extends down to the shore of Lake Champlain.The College has undergraduate programs in more than 50 majors and 20 graduate programs in diverse fields like business, law, healthcare administration, education, psychology, and others. Champlain College is known for its creative and innovative approach to higher education and the incorporation of practical learning with an academic curriculum.What is a degree?A degree is a certificate or diploma awarded to an individual after successfully completing an educational program at a college or university. The degrees awarded by colleges and universities signify the level of academic qualification of a person in a particular area of study. The four levels of degree qualifications are associate degrees, bachelor's degrees, master's degrees, and doctorate degrees. Degrees are often used as a measure of academic achievement and a criterion for job opportunities.

To know more about approximately visit:

https://brainly.com/question/27894163

#SPJ11

The correct answer is "All Champlain College Students are enrolled in at least one degree".

Every student at Champlain College is enrolled in at least one degree programme.

"Explanation:∀x∃!y, Enrolled(x, y) means that for every student x in Champlain College, there exists a unique degree y in which x is enrolled.The statement means that every student at Champlain College is enrolled in at least one degree, and only one degree, according to the expression. At Champlain College, each student is enrolled in at least one degree programmes.

Because of this, the correct alternative is "All Champlain College Students are enrolled in at least one degree.

"Therefore, option A is correct.

To know more about  programme, visit ;

https://brainly.com/question/26134656

#SPJ11

a 95onfidence interval for the mean was computed with a sample of size 90 to be (16,22). then the error is ±3.
true or false

Answers

The given statement is True. The statement "a 95% confidence interval for the mean was computed with a sample of size 90 to be (16, 22), then the error is ±3" is true.

In statistics, a confidence interval is a range of values that is used to estimate a population parameter such as a mean or proportion. It is a statement about a population parameter that is likely to contain the true value of the parameter.An interval estimate has an associated level of confidence that is given by the confidence level of the interval. This level of confidence is the probability that the interval will include the true population parameter if the procedure is performed several times.

Error in a confidence interval: The margin of error or confidence interval error is a measurement of how much the sample estimate varies from the true population parameter. It is a range of values above and below the sample estimate that encompasses the population parameter with a specified level of confidence. The formula for calculating the error or margin of error is given as: Error or margin of error = critical value × standard error of the statistic.

know more about confidence interval

https://brainly.com/question/32546207

#SPJ11

: A random sample of 100 observations from a normally distributed population possesses a mean equal to 84.3 and a standard deviation equal to 8.4. Use this information to complete parts a through e below. ~₂ a. Find a 90% confidence interval for μ.

Answers

The 90% confidence interval for the population mean is given as follows:

(82.9, 85.7).

What is a t-distribution confidence interval?

The t-distribution is used when the standard deviation for the population is not known, and the bounds of the confidence interval are given according to the equation presented as follows:

[tex]\overline{x} \pm t\frac{s}{\sqrt{n}}[/tex]

The variables of the equation are listed as follows:

[tex]\overline{x}[/tex] is the sample mean.t is the critical value.n is the sample size.s is the standard deviation for the sample.

The critical value, using a t-distribution calculator, for a two-tailed 90% confidence interval, with 100 - 1 = 99 df, is t = 1.6604.

The parameter values for this problem are given as follows:

[tex]\overline{x} = 84.3, s = 8.4, n = 100[/tex]

The lower bound of the interval is given as follows:

84.3 - 1.6604 x 8.4/10 = 82.9.

The upper bound of the interval is given as follows:

84.3 + 1.6604 x 8.4/10 = 85.7.

More can be learned about the t-distribution at https://brainly.com/question/17469144

#SPJ4

Evolution and Scientists. In a 2014 Pew Research survey of a representative sample of 3748 scientists connected to the American Association for the Advancement of Science (AAAS), 98% of them (3673 out of 3748) say they believe in evolution. Calculate a 95% confidence interval for the proportion of all scientists who say they believe in evolution. Round to 3 decimal places.

Answers

Given that In a 2014 Pew Research survey of a representative sample of 3748 scientists connected to the American Association for the Advancement of Science (AAAS), 98% of them (3673 out of 3748) say they believe in evolution.

To calculate a 95% confidence interval for the proportion of all scientists who say they believe in evolution. We need to find out the Margin of Error, Standard Error, and Sample Proportion Margin of Error Formula to calculate Margin of Error is given below;

\[\text{Margin of Error}=\text{Critical Value}\times\text{Standard Error}\]

Where,\[\text{Critical Value}=1.96\]

This value can be obtained using the Standard Normal Distribution table. Standard Error Formula to calculate Standard Error is given below;\[\text{Standard Error}=\sqrt{\frac{\text{Sample Proportion}\times(1-\text{Sample Proportion})}{\text{Sample Size}}}\]Sample Proportion\[=0.98\]Sample Size\[=3748\]

Putting these values in the Standard Error formula,\[\text{Standard Error}=\sqrt{\frac{0.98\times0.02}{3748}}\] \[\text{Standard Error}=0.007\]

Putting the calculated value of Standard Error and the Critical Value in the formula to calculate Margin of Error,\[\text{Margin of Error}=1.96\times0.007\] \[\text{Margin of Error}=0.014\]Now, we have Margin of Error and Sample Proportion\[=0.98\]

Formula to calculate the confidence interval is given below;\[\text{Confidence Interval}=\text{Sample Proportion}+\text{Margin of Error}\] and \[\text{Sample Proportion}-\text{Margin of Error}\]

Substituting the values, the 95% confidence interval is given below;\[0.98\pm0.014\]So, the 95% confidence interval for the proportion of all scientists who say they believe in evolution is\[0.966\le p\le0.994\]Hence,

the answer is, 0.966 ≤ p ≤ 0.994.

To know more about Formula refer to:

https://brainly.com/question/30098467

#SPJ11

1. What type of study is described in each of the following scenarios and what measure would you use in your data analysis?

a. The association between the percentages of people unemployed and coronary heart disease in Illinois counties.

b. Women that were diagnosed with breast cancer and women that were not-diagnosed with breast cancer were surveyed on their use of oral contraceptives.

c. A group of college freshman were grouped into two categories (non-exercisers, and exercisers) and followed for 25 years to detect the number of new cases of cardiovascular disease with each group.

d. A new drug was developed that will lower blood pressure. A group of people were placed into one of two treatment groups: one that received the new drug and a second that received the current drug used to treat high blood pressure.

Answers

The type of study described in each scenario and the measure to use in data analysis are:

a. Scenario A: The study is a correlation study. The measure that could be used in the data analysis is Pearson's correlation coefficient.

b. Scenario B: The study is an observational study. The measure that could be used in the data analysis is a relative risk.

c. Scenario C: The study is a cohort study. The measure that could be used in the data analysis is the incidence rate ratio.

d. Scenario D: The study is a clinical trial. The measure that could be used in the data analysis is the odds ratio or relative risk ratio.

To learn more about analysis, refer below:

https://brainly.com/question/32375844

#SPJ11

A movie theater is considering a showing of The Princess Bride for a 80's thowback night. In order to ensure the success of the evening, they've asked a random sample of 78 patrons whether they would come to the showing or not. Of the 78 patrons, 42 said that they would come to see the film. Construct a 98% confidence interval to determine the true proportion of all patrons who would be interested in attending the showing. What is the point estimate for the true proportion of interested patrons?

Answers

The point estimate for the true proportion of interested patrons is 42/78 = 0.5385 (rounded to four decimal places).

To construct a 98% confidence interval, we can use the formula for the confidence interval for a proportion. The standard error is calculated as the square root of (p_hat * (1 - p_hat) / n), where p_hat is the sample proportion and n is the sample size.

In this case, p_hat = 0.5385 and n = 78. Plugging these values into the formula, we find that the standard error is approximately 0.0566 (rounded to four decimal places).

To calculate the margin of error, we multiply the standard error by the appropriate z-score for a 98% confidence level. For a 98% confidence level, the z-score is approximately 2.3263 (rounded to four decimal places).

The margin of error is then 2.3263 * 0.0566 ≈ 0.1317 (rounded to four decimal places).

Finally, we can construct the confidence interval by subtracting the margin of error from the point estimate for the lower bound and adding the margin of error to the point estimate for the upper bound.

The 98% confidence interval is approximately 0.5385 - 0.1317 to 0.5385 + 0.1317, which simplifies to 0.4068 to 0.6702 (rounded to four decimal places).

Know more about Construct here:

https://brainly.com/question/791518

#SPJ11

Hypothesis Tests: For all hypothesis tests, perform the appropriate test, including all 5 steps.

o H0 &H1

o α

o Test

o Test Statistic/p-value

o Decision about H0/Conclusion about H1

500 people were asked their political affiliation (Republican, Democrat, Independent) and income level (Under $50,000, Above $50,000). The results were tabulated, and they produced the following results: Test Statistic: 7.25, P-value: 0.1233 At the 0.05 level of significance, test the claim that political affiliation is independent of income level.

Answers

The null and alternative hypotheses are given by;

H0: Political affiliation and income level are independent.

H1: Political affiliation and income level are dependent.

The level of significance (α) = 0.05

Step 1: Identify the test Statistical Test: Chi-square Test.

Step 2: Formulate an Analysis Plan Here, we need to compute the expected frequencies for each cell using the formula: Expected frequency of each cell = (Row total x Column total) / sample size. We can then use the chi-square formula below to find the test statistic and p-value;χ2 = ∑(Observed frequency - Expected frequency)2 / Expected frequency

Step 3: Analyze the Sample Data and Calculate the Test Statistic Using the given observed frequencies, we get; Test statistic = 7.25.

Step 4: Calculate the P-Value We can use a chi-square distribution table to obtain the p-value associated with the test statistic at a given level of significance (α).For α = 0.05, df = (r-1) x (c-1) = (3-1) x (2-1) = 2 and the critical value is 5.991. The p-value = P(χ2 > 7.25) = 0.026 < α

Step 5: Decision about H0/Conclusion about H1Since the p-value is less than α, we reject the null hypothesis, H0 and conclude that there is a significant relationship between political affiliation and income level among the 500 respondents. Therefore, we accept the alternative hypothesis, H1. Thus, political affiliation and income level are dependent among the 500 respondents. Answer: H0: Political affiliation and income level are independent.H1: Political affiliation and income level are dependent. Test Statistic: 7.25, P-value: 0.1233The level of significance (α) = 0.05.The decision about H0/Conclusion about H1 is that we reject the null hypothesis, H0 and conclude that there is a significant relationship between political affiliation and income level among the 500 respondents. Therefore, we accept the alternative hypothesis, H1. Thus, political affiliation and income level are dependent among the 500 respondents.

To know more about Chi-square Test refer to:

https://brainly.com/question/30391042

#SPJ11

A random sample of high school students is used to estimate the mean time all high school students study for Geometry tests. A 95% confidence interval based on this sample is: 0.9 hours to 2.7 hours.
What is the sample mean ( )?

Answers

If 95% confidence interval based on this sample is: 0.9 hours to 2.7 hours, the sample mean (x') is estimated to be 1.8 hours.

The sample mean (x;) is not explicitly given in the information provided. However, we can infer it from the 95% confidence interval.

A 95% confidence interval is typically constructed using the sample mean and the margin of error. The interval provided (0.9 hours to 2.7 hours) represents the range within which we are 95% confident the true population mean lies.

To find the sample mean, we take the midpoint of the confidence interval. In this case, the midpoint is (0.9 + 2.7) / 2 = 1.8 hours.

The 95% confidence interval indicates that, based on the sample data, we are 95% confident that the true mean time all high school students study for Geometry tests falls between 0.9 hours and 2.7 hours, with the estimated sample mean being 1.8 hours.

To learn more about sample mean click on,

https://brainly.com/question/15201212

#SPJ4

The approximation of 1 = $, (x – 3)ex?dx by composite Trapezoidal rule with n = 4 is: 4.7846 15.4505 -5.1941 -25.8387

Answers

The approximation of the integral [tex]\int (x - 3) * e^x dx[/tex] using the composite Trapezoidal rule with n = 4 is approximately -1.670625.

We'll proceed with the default values and calculate the approximation using the composite Trapezoidal rule with n = 4.

Using the default interval [a, b] (which is not specified), we'll assume it to be [0, 1] for demonstration purposes. Therefore, a = 0 and b = 1.

First, we need to calculate the step size, h:

[tex]h = (b - a) / n\\h = (1 - 0) / 4\\h = 0.25[/tex]

Now, we can calculate the approximation using the composite Trapezoidal rule formula:

[tex]Approximation = (h/2) * [f(x_0) + 2 * (sum\ of f(x_i)) + f(x_n)]\\Approximation = (0.25/2) * [f(0) + 2 * (f(0.25) + f(0.5) + f(0.75)) + f(1)][/tex]

Let's evaluate the function at these points:

[tex]f(0) = (0 - 3) * e^0 = -3\\f(0.25) = (0.25 - 3) * e^{0.25} = -2.195\\f(0.5) = (0.5 - 3) * e^{0.5} = -1.373\\f(0.75) = (0.75 - 3) * e^{0.75} = -0.732\\f(1) = (1 - 3) * e^1 = -1.765[/tex]

Substituting these values into the formula:

[tex]Approximation = (0.25/2) * [-3 + 2 * (-2.195 - 1.373 - 0.732) - 1.765]\\Approximation = (0.125) * [-3 + 2 * (-4.3) - 1.765]\\Approximation = (0.125) * [-3 - 8.6 - 1.765]\\Approximation = (0.125) * [-13.365]\\Approximation = -1.670625[/tex]

Therefore, the approximation of the integral using the composite Trapezoidal rule with n = 4 is approximately -1.670625.

To know more about approximation, refer here:

https://brainly.com/question/29669607

#SPJ4

If the year ends on a Thursday for a company that has 2 employees, each earning $500 per week, assuming a 5-day work week with payday every Friday, what is the required adjusting entry? What accounts would be found on the Adjusted Trial Balance but not on the Post-Closing Trial Balance? Show the entry to record $400 of depreciation for the period.

Answers

The required adjusting entry is to debit salaries expense for $1,000 and credit salaries payable for $1,000 because, at year-end, the employees have earned two days of wages, which have not yet been paid.

Salaries payable are a liability account, and they will appear on the adjusted trial balance and the post-closing trial balance. What accounts would be found on the Adjusted Trial Balance but not on the Post-Closing Trial Balance? In the adjusted trial balance, all accounts with balances are listed, including the ones that have been adjusted.

Whereas in the post-closing trial balance, only the permanent accounts are listed. Therefore, temporary accounts such as revenues, expenses, and dividends, will appear on the adjusted trial balance but not on the post-closing trial balance.

The entry to record $400 of depreciation for the period is the Debit depreciation expense for $400 and credit accumulated depreciation for $400. The depreciation expense account is an expense account, and it appears on the income statement, which is a temporary account. On the other hand, the accumulated depreciation account is a contra-asset account and it appears on the balance sheet, which is a permanent account.

Therefore, depreciation expense will appear on the adjusted trial balance but not on the post-closing trial balance while accumulated depreciation will appear on both the adjusted trial balance and the post-closing trial balance.

Learn more about trial balance at: https://brainly.com/question/30913340

#SPJ11

Solve for X: x/7=x-5/5

Answers

the exact form is X= 7/6

An engineer is designing a machine to manufacture gloves and she obtains the following sample of hand lengths (mm) of randomly selected adult males based on data gathered: 173 179 207 158 196 195 214 199 Define this data set as discrete or continuous. The hand lengths is what type of level of measurement? Compare the mean and median for this data set and if you can draw any conclusions from these values.

Answers

The given data set represents the hand lengths of randomly selected adult males which include 173, 179, 207, 158, 196, 195, 214, 199.

Let us answer each question one by one. The given data set represents a discrete level of measurement. The reason is that the hand lengths of the adult males are counted and the measured values do not include a continuous range of data. Hence, it is considered as a discrete level of measurement. Hand lengths level of measurement The given data set represents an interval level of measurement. The reason is that the values of hand lengths are measured on a scale that is divided into equal intervals. The units of hand lengths are in millimeters. Hence, the hand lengths level of measurement is an interval level. Mean and median for this data set

The mean and median for this data set is calculated as follows: Mean = (173 + 179 + 207 + 158 + 196 + 195 + 214 + 199) / 8 = 188.125Median = The middle term is (7+1)/2 = 4th term= 196The mean and median values indicate that the distribution of hand lengths is skewed to the left since the median is greater than the mean. Thus, it can be concluded that the majority of the hand lengths are below the median of 196 mm.

To know more about median refer to:

https://brainly.com/question/14532771

#SPJ11

Question: Exercise 3: Here, We Will Study Permutations Of The Letters In A Word: ‘XXXL’ A) If The Order Of Every Letter In Your Word Counts Write Down All Different Words You Can Make (The Words Don’t Have To Mean Anything ! ). B) How Many Different Words Could You Make In A) ? C) Now, If The Order Of The Same Letters Don’t Count, Write Down All Different Words You
Exercise 3:
Here, we will study Permutations of the letters in a word: ‘XXXL’

a) If the order of every letter in your word counts write down all different words you can make (the words don’t have to
mean anything ! ).

b) How many different words could you make in a) ?

c) Now, if the order of the same letters don’t count, write down all different words you can make (the words don’t have to mean anything). That is, for example, P1A1P2A2 and P2A1P1A2 now counts as one word.
How many different words can you make now ?

d) Only using factorials, can you say what the answer to b) is ?
Only using a ratio of factorials, can you say what the answer to c) is ?
( example of a factorial is 5!=5*4*3*2*1 )

Answers

a) When the order of every letter in the word 'XXXL' counts, we can create the following different words: XXXL, XXLX, XLXX, and LXXX.

b) The number of different words we can make in part a) is 4.

c) If the order of the same letters doesn't count, we can create the following different words: XXXL, XXL, XL, and L.

c) The number of different words we can make in part c) is also 4.

d) Using factorials, we can determine the answer to part b) by calculating 4! (4 factorial), which equals 24.

e) Using a ratio of factorials, we can determine the answer to part c) by dividing 4! by 3! (the factorial of the repeated letter 'X'), which also equals 4.

a) If the order of every letter in the word 'XXXL' counts, we can generate different words by permuting the letters.

The possible words are:

XXXL

XXLX

XLXX

LXXX

b) The number of different words we can make in part a) is 4.

c) If the order of the same letters doesn't count, we need to consider combinations instead of permutations. The possible words are:

XXXL

XXL

XL

L

c) The number of different words we can make in part c) is 4.

d) To calculate the number of different words in part b) using factorials, we can use the formula for permutations of n objects taken all at a time, which is n!.

In this case, n = 4 (the number of different letters), so the answer can be calculated as 4!.

4! = 4 x 3 x 2 x 1 = 24

So, the answer to part b) using factorials is 24.

e)

To calculate the number of different words in part c) using a ratio of factorials, we divide the total number of permutations (part b) by the factorial of the number of repeated letters (in this case, 'X').

Number of different words = Total permutations / (Factorial of repeated letters)

Number of different words = 4! / (3!)

3! = 3 x 2 x 1 = 6

Number of different words = 24 / 6 = 4

So, the answer to part c) using a ratio of factorials is 4.

To learn more on Permutations click:

https://brainly.com/question/29855401

#SPJ4

what returns a single table variable that can be created by a select statement?

Answers

A table-valued function (TVF) returns a single table variable that can be created by a select statement. TVFs are user-defined functions that return a table data type.

A SELECT statement in a database query language (such as SQL) allows you to retrieve data from one or more tables or views.They can be used after the FROM clause in the SELECT statements so that we can use them just like a table in the queries. When you execute a SELECT statement, it processes the specified conditions and retrieves the requested data, which is returned as a table variable. This table variable contains rows and columns that match the query's selection criteria and column specifications.

To know more about SELECT statements here: brainly.com/question/31497842

#SPJ11

Mortgage companies usually charge interest semi-annually. What would be the effective rate of interest on a mortgage at 8.15 percent compounded semi-annually? O a. 8.23 percent O b. 8.32 percent O c. 8.46 percent O d. 8.40 percent If you want to save $1,000,000 for retirement with $200 monthly deposits (end-of-month) at 6 percent interest compounded monthly, how long will it take? O a. 54.4 years O b. 55.9 years O c. 52.8 years O d. 57.2 years

Answers

a) The effective rate of interest on a mortgage at 8.15 percent compounded semi-annually is 8.23 percent.

b) It will take approximately 54.4 years to save $1,000,000 for retirement with $200 monthly deposits at 6 percent interest compounded monthly.

a) To find the effective rate of interest, we use the formula: Effective Rate = (1 + (Nominal Rate / Number of Compounding Periods))^Number of Compounding Periods - 1.

For a mortgage at 8.15 percent compounded semi-annually, the nominal rate is 8.15 percent and the number of compounding periods is 2 per year.

Plugging these values into the formula, we get Effective Rate = (1 + (0.0815 / 2))^2 - 1 ≈ 0.0823, or 8.23 percent. Therefore, the effective rate of interest on the mortgage is 8.23 percent.

b) To determine how long it will take to save $1,000,000 for retirement with $200 monthly deposits at 6 percent interest compounded monthly, we can use the formula for the future value of an ordinary annuity: FV = P * ((1 + r)^n - 1) / r, where FV is the future value, P is the monthly deposit, r is the monthly interest rate, and n is the number of periods.

Rearranging the formula to solve for n, we have n = log(FV * r / P + 1) / log(1 + r). Plugging in the values $1,000,000 for FV, $200 for P, and 6 percent divided by 12 for r, we get n = log(1,000,000 * (0.06/12) / 200 + 1) / log(1 + (0.06/12)) ≈ 54.4 years.

Therefore, it will take approximately 54.4 years to save $1,000,000 for retirement under these conditions.

Learn more about interest rate here:

https://brainly.com/question/32020793

#SPJ11

A projectile is fired from from a platform 5 feet above the ground with an initial velocity of 75 feet per second at an angle of 30∘with the horizontal. Find the maximum height and range of the projectile.

Answers

The maximum height of the projectile is approximately 45.64 feet, and the range is approximately 324.76 feet.


To find the maximum height and range of the projectile, we can analyze the motion of the projectile using the equations of motion. Considering the projectile's initial velocity of 75 feet per second at an angle of 30 degrees, we can break it down into its horizontal and vertical components.
The horizontal component of the velocity remains constant throughout the motion and is given by Vx = V₀ *cos(θ), where V₀ is the initial velocity and θ is the launch angle. In this case, Vx = 75 * cos(30°) = 64.95 feet per second.
The vertical component of the velocity changes due to gravity. The equation for the vertical velocity as a function of time is Vy = V₀ * sin(θ) - g * t, where g is the acceleration due to gravity (approximately 32.2 feet per second squared). At the maximum height, the vertical velocity becomes zero. Using this information, we can find the time it takes to reach the maximum height: 0 = 75 * sin(30°) - 32.2 * t_max. Solving for t_max, we get t_max ≈ 1.46 seconds.Using the time at the maximum height, we can find the maximum height (H) using the equation H = V₀ * sin(θ) * t_max - 0.5 * g * t_max². Substituting the values, we get H ≈ 45.64 feet.
The range of the projectile (R) can be found using the equation R = Vx * t_total, where t_total is the total time of flight. The total time of flight can be found using the equation t_total = 2 * t_max. Substituting the values, we get R ≈ 324.76 feet.
Therefore, the maximum height of the projectile is approximately 45.64 feet, and the range is approximately 324.76 feet.

Learn more about range here

https://brainly.com/question/29204101



#SPJ11

Dean of the university estimates that the mean number of classroom hours per week for full-time faculty is 11.0. As a member of the student council, you want to test this claim. A random sample of the number of classroom hours for eight full-time faculty for one week is listed below. At α=0.01, can you reject the dean's claim?
11.8 8.6 12.6 7.9 6.4 10.4 13.6 9.1

a. Find the critical value(s), and identify the rejection region(s).
b. Find the standardized test statistic.

Answers

The standardized test statistic is 0.5809, which is less than the critical value of 2.998 for a two-tailed test at 7 degrees of freedom and α=0.01. Therefore, we do not reject the null hypothesis.

Next, we explain how we obtained this answer using the given information, formulas, and calculations.

Given that α=0.01 and a two-tailed test, we find the critical value using a t-distribution table.

The degrees of freedom are 7 (sample size n-1=8-1=7). The critical value is t=2.998.

The rejection region is the two tails of the t-distribution, corresponding to t-values greater than 2.998 or less than -2.998.

We use the formula [tex]t = \frac{\bar{x}-\mu}{\frac{s}{\sqrt{n}}}[/tex] to find the standardized test statistic,

where [tex]\bar{x}[/tex]is the sample mean, μ is the population mean, s is the sample standard deviation, and n is the sample size.

We first calculate the sample standard deviation using the formula [tex]s = \sqrt{\frac{\sum(x_i-\bar{x})^2}{n-1}}[/tex]

where [tex]x_i[/tex] are the eight classroom hours values given in the problem.

We get [tex]s\approx2.8077.[/tex]

We then substitute this value and other values from the problem into the formula for t and get t≈0.5809.

Based on our calculations, we conclude that the standardized test statistic is 0.5809, which is less than the critical value of 2.998 for a two-tailed test at 7 degrees of freedom and α=0.01. Therefore, we do not reject the null hypothesis.

To know more about  critical value  Visit :

https://brainly.com/question/31828911

#SPJ11

Which of the following polynomial does not belong to the span{P_1, P_2} if
p_1(t)= -5t^2 – 1 and p_2(t) = 2t^2+t?
a. p(t)= - 25t^2 – 5t-3
b. None of them
c. p(t)=9t^2 +2t+1
d. p(t)= 14t^2 - 3t+2
e. p(t)= -3t^2+t-1

Answers

The answer is option (a) , the polynomial p(t) = [tex]-25t^2 - 5t - 3[/tex] does not belong to the span{P_1, P_2}.

To determine which polynomial does not belong to the span{P_1, P_2}, we need to check if it is possible to write each polynomial as a linear combination of P_1 and P_2. If a polynomial cannot be written as a linear combination of P_1 and P_2, then it does not belong to their span.

Let's express each polynomial in the form of a linear combination of P_1 and P_2:

a. p(t) =[tex]-25t^2 - 5t - 3 = -5(-5t^2 - t) + (-3t^2 + 0t) = -5P_1(t) + (-3t^2)[/tex]

b. None of them (all polynomials can be expressed as a linear combination of P_1 and P_2)

c. p(t) = [tex]9t^2 + 2t + 1 = (9/2)P_1(t) + (5/2)P_2(t)[/tex]

d. p(t) = [tex]14t^2 - 3t + 2 = (14/11)P_1(t) + (25/11)P_2(t)[/tex]

e. p(t) =[tex]-3t^2 + t - 1 = (-3/2)P_1(t) + (5/2)P_2(t)[/tex]

Since we were able to express all polynomials except option (a) as a linear combination of P_1 and P_2, the answer is option (a). Therefore, the polynomial p(t) =[tex]-25t^2 - 5t - 3[/tex] does not belong to the span{P_1, P_2}.

Learn more about Polynomial Span :

https://brainly.com/question/31857690

#SPJ11

​ T(t)equals=temperature
t minutes after midnight in Chicago on January 1.
Choose the correct answer below.
A.
The function​ T(t) is continuous because the temperature changes gradually as time​ increases, with no jumps in between.
B.
The function​ T(t) is continuous because the temperature is a constant.
C.
The function​ T(t) is discontinuous because the temperature changes quickly.
D.
The function​ T(t) is discontinous because the temperature varies throughout the night.

Answers

The correct answer is A. The function T(t) is continuous because the temperature changes gradually as time increases, with no jumps in between.

In this context, a continuous function means that the temperature changes smoothly and continuously with time, without any abrupt or sudden changes. Since the temperature is expected to change gradually over time, there are no jumps or discontinuities in the function. Option B is incorrect because the temperature being constant would imply that there are no changes at all, which is unlikely for a given day in Chicago.

Option C is incorrect because it states that the temperature changes quickly, implying abrupt changes, which contradicts the expectation of gradual changes mentioned in the problem. Option D is incorrect because it suggests that the temperature varies throughout the night, which is expected and does not indicate discontinuity.

To learn more about discontinuity, click here:

brainly.com/question/30089262

#SPJ11

Let
A=⎡⎣⎢10−211−1−215⎤⎦⎥ and b=⎡⎣⎢3−1−7⎤⎦⎥.
Define the linear transformation T:R2→R2
as T(x)=Ax
. Find a vector x
whose image under T
is b
.
x=
Is the vector x
unique? (enter YES or NO)

Answers

The vector x whose image under T is b is given by: x=[35] and the vector x is unique and the answer is NO.

Let A=⎡⎣⎢10−211−1−215⎤⎦⎥ and b=⎡⎣⎢3−1−7⎤⎦⎥.We are given that a linear transformation T:R2→R2 as T(x)=Ax and we need to find a vector x whose image under T is b. We have to solve the system Ax=b to find the vector x. Using elementary row operations, we have to bring the augmented matrix [A|b] into row echelon form and then solve the system as follows:1→2:R2R2−2R1→R2[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]R3−3R1→R3[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]R3−7R2→R3[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]→[10−211−1−215∣∣3−1−7]So the system of linear equations becomes :[10−211−1−215∣∣3−1−7][10−211−1−215∣∣3−1−7][10−211−1−215∣∣3−1−7][10−211−1−215∣∣3−1−7]The above system has row echelon form. By back substitution we have:z=−4y+3x−7y+5x=3Which gives the solution: x=[35]Therefore, the vector x whose image under T is b is given by: x=[35].Hence, the vector x is unique and the answer is NO.

Learn more about linear transformation here,https://brainly.com/question/31472585

#SPJ11

Which equation can be used to find the measure of EHG?

mEHG + 80 + 35 = 180
mEHG + 80 + 35 = 360
mEHG – 80 – 35 = 360
mEHG – 80 – 35 = 180

Answers

Given: mEHG + 80 + 35 = 180 Adding the like terms on the left-hand side, we get mEHG + 115 = 180

Subtracting 115 from both sides, we obtain mEHG + 115 - 115 = 180 - 115mEHG = 65

Hence, the equation that can be used to find the measure of EHG is mEHG = 65.

An expression that supports the equality of two expressions connected by the equals sign "=" is an equation. 2x – 5 for instance gives us 13 2x – 5 and 13 are expressions in this case. "=" serves as the connecting sign between these two expressions.

Expressions that are both equal to one another make up an equation. A recipe is a condition with at least two factors that addresses a connection between the factors. A line of the form y = m x + b, where m is the slope and b is the y-intercept, is an illustration of a linear system.

Know more about equation:

https://brainly.com/question/29538993

#SPJ11

The oxygen index in an aquarium is represented by following equation : 1 = x + y - 9xy + 27 where x and y are the coordinates in xy plane. Solve for the absolute extrema values for oxygen index on the region bounded by 0 S x s5 and 0 sy s 5. Identify the location in the aquarium with the lowest oxygen index. List down all the assumptions/values/methods used to solve this question. Compare the answer between manual and solver program, draw conclusion for your finding

Answers

The lowest oxygen index in the aquarium is found at the location (5, 5) in the xy plane, where the oxygen index value is -192.

To compute the absolute extrema values of the oxygen index function in the region, we need to evaluate the function at its critical points and at the boundary points.

1: Find the critical points:

To find the critical points, we need to find the values of x and y where the partial derivatives of the oxygen index function are equal to zero.

∂(oxygen index)/∂x = 1 - 9y = 0   --->   y = 1/9

∂(oxygen index)/∂y = 1 - 9x = 0   --->   x = 1/9

So, the critical point is (1/9, 1/9).

2: Evaluate the function at the boundary points:

We need to evaluate the oxygen index function at the boundary points (0,0), (5,0), (0,5), and (5,5).

At (0,0):

oxygen index = 1 + 0 - 9(0)(0) + 27 = 1 + 0 + 0 + 27 = 28

At (5,0):

oxygen index = 1 + 5 - 9(5)(0) + 27 = 1 + 5 + 0 + 27 = 33

At (0,5):

oxygen index = 1 + 0 - 9(0)(5) + 27 = 1 + 0 + 0 + 27 = 28

At (5,5):

oxygen index = 1 + 5 - 9(5)(5) + 27 = 1 + 5 - 225 + 27 = -192

3: Compare the function values:

Now, we compare the function values at the critical point and the boundary points to find the absolute extrema.

Critical point: (1/9, 1/9) → oxygen index = 1 + (1/9) - 9(1/9)(1/9) + 27

                                           = 1 + 1/9 - 1/9 + 27

                                           = 28

Boundary points:

- Lowest oxygen index: (5,5) → oxygen index = -192

- Highest oxygen index: (5,0) → oxygen index = 33

Therefore, the location in the aquarium with the lowest oxygen index is at coordinates (5, 5).

To know more about absolute extrema refer here:

https://brainly.com/question/29281332#

#SPJ11

Recall the following corollary to Fermat’s Little Theorem: If p is a prime, then a p ≡ a(mod p) for any integer a.
a. Use this result to prove the following lemma: If p and q are distinct primes with a^p ≡ a(mod q) and a^q ≡ a(mod p), then a^pq ≡ a(mod pq).
b. Use the result in part a. to establish that 2^340 ≡ 1(mod 341). Hence, the converse of Fermat’s Little Theorem is false

Answers

a. Since a(a - 1) ≡ 0 (mοd pq), we can cοnclude that [tex]a^pq[/tex] ≡ a (mοd pq), which cοmpletes the prοοf οf the lemma.

b. We have shοwn that [tex]2^{340[/tex] ≡ 1 (mοd 341), and this demοnstrates that the cοnverse οf Fermat's Little Theοrem is false.

Hοw tο prοve the lemma?  

A lemma (plural lemmas or lemmata) is a generally modest, proven claim that is used as a stepping stone to a larger conclusion in informal logic and argument mapping. It is often referred to as a "helping theorem" or a "auxiliary theorem" because of this.

a.Tο prοve the lemma, we'll use Fermat's Little Theοrem and the given cοngruence relatiοns.

Let's prοceed with the prοοf step by step:

We have [tex]a^p[/tex] ≡ a (mοd q) and [tex]a^q[/tex] ≡ a (mοd p).

Frοm Fermat's Little Theοrem, since p is prime, we knοw that [tex]a^p[/tex]  ≡ a (mοd p). Thus, we can rewrite the first cοngruence relatiοn as [tex]a^p[/tex] ≡ a (mοd q) ≡ a (mοd p).

Similarly, using Fermat's Little Theοrem, we have [tex]a^q[/tex] ≡ a (mοd q) ≡ a (mοd p).

Nοw, let's cοnsider the prοduct [tex]a^p * a^q[/tex]. Using the cοngruence relatiοns frοm step 2 and 3, we can write:

[tex]a^p * a^q[/tex] ≡ a * a (mοd p) ≡ [tex]a^2[/tex] (mοd p),

and [tex]a^p * a^q[/tex] ≡ a * a (mοd q) ≡ [tex]a^2[/tex] (mοd q).

Since [tex]a^2[/tex]  ≡ [tex]a^2[/tex] (mοd p) and [tex]a^2[/tex] ≡ [tex]a^2[/tex] (mοd q), it fοllοws that [tex]a^2[/tex] ≡ [tex]a^2[/tex] (mοd pq), since p and q are distinct primes.

Nοw, we can rewrite the cοngruence relatiοn frοm step 5 as:

[tex]a^2[/tex] ≡ [tex]a^2[/tex] (mοd pq),

which implies [tex]a^2[/tex] - [tex]a^2[/tex] ≡ 0 (mοd pq).

Factοring the left side οf the cοngruence, we have:

[tex]a^2 - a^2[/tex]  ≡ (a - a)(a + a) ≡ 0 (mοd pq),

which simplifies tο [tex]a^2 - a^2[/tex] ≡ 0 (mοd pq).

Dividing bοth sides by (a - a), we get:

[tex]a^2 - a^2[/tex] ≡ 0 (mοd pq) ⟹ a(a - 1) ≡ 0 (mοd pq).

Finally, since a(a - 1) ≡ 0 (mοd pq), we can cοnclude that [tex]a^pq[/tex] ≡ a (mοd pq), which cοmpletes the prοοf οf the lemma.

b. Tο use part a οf the lemma tο establish that [tex]2^{340[/tex]  ≡ 1 (mοd 341), we need tο shοw that the cοnditiοns οf the lemma are satisfied.

Let's cοnsider p = 11 and q = 31, which are distinct primes, and a = 2. We can verify that [tex]2^{11[/tex] ≡ 2 (mοd 31) and [tex]2^{31[/tex] ≡ 2 (mοd 11) by calculating the values.

Using part a οf the lemma, we cοnclude that [tex]2^{341[/tex] ≡ 2 (mοd 341). Hοwever, since 341 = 11 * 31, we have [tex]2^{341[/tex] ≡ [tex]2^{0[/tex] ≡ 1 (mοd 341).

Hence, we have shοwn that [tex]2^{340[/tex] ≡ 1 (mοd 341), and this demοnstrates that the cοnverse οf Fermat's Little Theοrem is false.

To know more about Fermat’s Little Theorem, refer here:

https://brainly.com/question/30761350

#SPJ4

Other Questions
why is yhe greatest amoug of eergy soted in a molecyle of atp The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment?