You are told that 20% of a population is homzygous recessive. What variable is that referring to in the Hardy Weinberg equations?

Answers

Answer 1

Answer:

The variables and are specifically referring to the allele frequencies of the dominant and the recessive allele in a population, respectively.


Related Questions

What is the formula to find out the energy when given the energy?

Answers

2
KE=0.5×m×v
2
I think

Which of the following fresh water biomes consists of moving water

Answers

Answer:

Biomes consists of moving water is estuaries.

which role do plants play in the nitrogen cycle?

Answers

Answer:

C .they take up the usable forms of nitrogen found in the soil .

Explanation:

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

helpppp I’ll do anything BUT I HATE links so please NO links

Answers

Mitochondria: supplies energy to the cell

Nucleus: Control center of the cell; contains DNA

Ribosomes: makes proteins inside cell

Cell membrane: protective layer of the cell

Hope this helps :)

Mitochondria: source of energy to cell

Nucleus: contains dna and controls center

Ribosomes: produces protein

Cell membrane: gives protection

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

Both Mrs. Smith and Mrs. Jones had babies the same day in the same hospital. Mrs. Smith took home a baby girl named Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect, however, that her baby had been accidently been switched with the Smith baby in the nursery. Blood tests were made. Mr. Smith was blood type A, Mrs. Smith was type B, Mr. Jones was type A, Mrs. Jones was type A. Shirley was type O, and Jane was type B. Had a mix-up occurred? SHOW WORK!

Answers

Answer:

yes a mixup had occured because two A blood types would result in a baby with the same blood unle mr.jones wasnt the father

Explanation:

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

extrusive rocks have larger grains than intrusive rocks.true or false and why

Answers

False because extrusive rocks have fine-grained texture due to the rapid cooling of magna above the earth surface. On the other hand extrusive rocks have course grained texture due to slow cooling of magna beneath the Earth's surface

In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only

Answers

Answer :the answer is D

Explanation:

As a discussed in the lesson, eukaryotic cels are differ from prokaryotic cells based on what three things?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

answer and show proof for brainliest

Answers

Answer:

C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.

Explanation:

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

in developing countries, which of the following is predicted to happen to both population and demand for meat and milk?

A. it will double by 2050
B. it will decrease by 2050
C. it will stay the same in 2050
D. it will increase slightly by 2050​

Answers

number c is the answer

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

What are examples of convections currents? What are examples of convection currents? A: the movement of war air into cooler air and cooler air into warmer air B: the movement of cool water into warmer water and warmer water into cool water. C: the displacement of air/water molecules by other air/water molecules due to varying temperatures. D: all of the above

Answers

Answer:

C: the displacement of air/water molecules by other air/water molecules due to varying temperatures

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Other Questions
What is the main theme or message? Which term describes the QuickBooks Online accounting system? Answer: A. Cash B Cloud-based C. Summary D. Double-entry lorld War | BeginsssignmentActiveBritish PerspectiveBackground information: David Lloyd George wasmember of the British Parliament during World WanWhat is David Lloyd George's perspective on WorldWarThis IS excerpt is from his memoirs.The nations slithered over the brink into the boilingNations were racing toward war withclear sensecauldron of war without any trace of apprehension orof caution.dismay. Amongst the rulers and statesmen who aloneNations wanted to participate in war on a verycould give the final word which caused great armies togrand scale.spring from the ground and march to and acrossfrontiers, one can seenow clearly that not one of themNations did not understand the extensivewanted war; certainly not on this scale.implications this war would have.-War Memoirs of David Lloyd George,Nations only participated in this war to enhancetheir armies.1933 What does A Modest Proposal purpose? What happens if you put 100 grams of sugar to a 100 mL of water? which of the following is a key concept in wachtel's cyclical psychodynamic-behavior therapy? question 29 options: clients' behaviors demonstrate a cycle of acting on demands from their id and superego until they can find a balance. clients are seeking personal growth and must have basic needs met before they can fulfill self-actualization. people will repeat negative patterns of behavior until they are able to gain insight into the causes and consequences of those behaviors. the relationship between the therapist and client shows a cycle of positive and negative interactions during treatment, and those must be addressed as they occur. Determine the volume (in mL) of water that needs to be added to 50.0 mL of a 0.600 M LiBr to produce a 0.145 M solution. Assume the volumes are additive. What are the positive impacts of westernization? What are 3 important things about coral reefs? Use the velocity versus time graph below to answer the question. From 0 seconds to 15 seconds, what is true about the car? A. It has a constant velocity B. It has a negative accelerationC. It has a positive accelerationD. It is not moving Which is a feature of a Super PAC? you manage a network with multiple subnets connected to the internet. a user reports that she can't access the new server used in the accounting department. you check the problem and find out that her computer cannot access any server on that subnet. however, the computer does access other computers on other subnets as well as the internet. which of the following is most likely the cause of the problem? Bloodtype phenotype GenotypeA+B+A-B-AB+O+O- What are the major crops of our country Class 8? All death-row inmates are held in ________ prisons. In what Supreme Court case did the Court rule the school may restrict student speech in a school newspaper? In which of the following ways are the processes that occur in electrolytic cells the opposite of those occuring in galvanic cells? Select all that apply. O In electrolytic cells, chemical energy is produced from electrical energy. In galvanic cells, the converse is true. O Electrolytic cells contain nonspontaneous reactions, while the reactions in galvanic cells are spontaneous. O In electrolytic cells, reduction occurs at the anode rather than at the cathode (as it does in galvanic cells). O In electrolytic cells, the cathode is negatively charged, while the anode is positively charged (the reverse is true for galvanic cells) What does revenge mean as a theme? How has the family survived financially for the last few years?by selling jewelryby renting their homeby selling items in the streetby the money Gregor earned at his job Although you usually believe that personality tests are not usedful in hiring context, you feel they are appropriate in this case because the interviewer took the time to explain why the organization uses them and how they will be used. You are unhappy after leaving a job interview bc the interviewer ate her lunch and took two calls while you were being interviewed for the job.