Rewrite the following four sentences to be more concise. Remember, don't lose any meaning, just state the meaning more concisely:

My mother was annoyed because of the fact that I arrived late.

I have found Mark to be the most vicious gossip I know.

During the time in which Maria wrote the conclusion, the secretary finished typing.

With regard to the memo you sent me, I am of the opinion that we should inform our employees of the new policy quickly.

Answers

Answer 1

Answer

1) My mother was annoyed I arrived late.

2) Mark is a vicious gossiper.

3) As Maria wrote the conclusion, the secretary finished typing.

4) We should inform our employees of the new policy quickly.

Explanation:

I just made the sentences more straight-to-the-point and took away words that were adding no meaning such as "because of the fact that" and "during the time in which".


Related Questions

With a(n) ______ audience it's important to use subtle persuasive tactics.
A. apathetic.
B. uninformed.
C. negative.
D. positive.

Answers

Answer:

B. Uninformed

2. A proofreading mark of three short
lines indicates that
O a word should be removed
O a word should be capitalized
O a new paragraph should created
O a paragraph should be separated

Answers

A proofreading mark of three short lines indicates that a word should be removed. Thus, option A is correct.

An activity in which someone shows, describes, or explains something to a group of people. The charts and graphs helped me understand the presentation. She will take your questions after she has made her presentation. The senior accountant gave a presentation at the meeting.

In this case, a compound sentence us a sentence that has two independent clauses.

Therefore, A proofreading mark of three short lines indicates that a word should be removed. Thus, option A is correct.

Learn more about Presentation at:

brainly.com/question/820859

#SPJ1

Which three sentences correctly paraphrase the sentence without changing the meaning or leaving out important information?

Answers

The three sentences that correctly paraphrase the sentence without changing the meaning or leaving out important information are;

November 11 was declared a legal holiday by an Act passed on May 13, 1938 (U.S. Dept. of Veterans Affairs).The Act that made November 11 a legal holiday was approved on May 13, 1938 (U.S. Dept. of Veterans Affairs).On May 13, 1938, the government passed an Act that declared November 11 as an official holiday (U.S. Dept. of Veterans Affairs).What is the correct way to paraphrase?

When a person is paraphrasing, they are simply restating someone else's ideas or words in your own words while retaining the original meaning.

To do it correctly, they should consider, Understand the original text, use their own words, identify the meaning of the text and interpret it as it has been interpreted.

The above answer is based on the full question below;

An Act approved on May 13, 1938 made the 11th of November in each year a legal holiday.

Which three sentences correctly paraphrase the sentence without changing the meaning or leaving out important information?

November 11 was declared a legal holiday by an Act passed on May 13, 1938 (U.S. Dept. of Veterans Affairs).

The Act that made November 11 a legal holiday was approved on May 13, 1938 (U.S. Dept. of Veterans Affairs).

November 11 of each year was a legal holiday (U.S. Dept. of Veterans Affairs).

On May 13, 1938, the government passed an Act that declared November 11 as an official holiday (U.S. Dept. of Veterans Affairs).

Approved on May 13, 1938, 11th of November in each year was a legal holiday (U.S. Dept. of Veterans Affairs).

An Act, approved on May 13, 1938, made the 11th of November in each year a legal holiday (U.S. Dept. of Veterans Affairs).

Find more exercises that involves paraphrase;

https://brainly.com/question/5032491

#SPJ1

kisses from katie chapter 13 summary​

Answers

The summary of Kisses from Katies: A story of relentless Love and Redemption by Katies Davies speaks to resilience, love and compassion.

What is the summary about?

The thirteenth chapter of "Kisses from Katie" portrays Katie's experiences as she works tirelessly to provide medical help and monetary aid to a young girl named Florence, who has sustained severe burns.

Despite cultural and linguistic differences, Katie defies the odds and establishes a profound connection with Florence and her family.

This endeavor enables her to recognize the significance of resilience, compassion, and love in adverse circumstances while underscoring the obstacles inherent in working within constrained resources.

Learn more about summary at:

https://brainly.com/question/27029716

#SPJ1

3 QUESTIONS! I'LL GIVE BRAINLIEST!

1. Which infographic is the best mix of text and visuals?


What Do Colors Mean?

Obesity in America

The People of the United States



2. Which infographic is mainly visuals, with a small amount of information?


The People of the United States

What Do Colors Mean?

Obesity in America



3.Andrea needs to create an infographic to help her learn new words for a social studies quiz. What type of information should she present?


dates and stages

similarities and differences

vocabulary

data

Answers

Answer:

The best mix of text and visuals would likely be "Obesity in America" since it contains a balance of visual representations and textual information.

"The People of the United States" is mainly visual, with a small amount of information.

Since Andrea needs to learn new words for a social studies quiz, she should present vocabulary information in her infographic.

Which of the words in this sentence are adjectives? The driest area in the world is a desert in Chile.

Answers

In the sentence "The driest area in the world is a desert in Chile," the adjective words are "driest" and "Chilean". "Driest" describes the degree of dryness of the area and "Chilean" specifies the location of the desert. However, in the given sentence, "Chilean" is not an adjective, it should be "Chile." So the correct answer is "driest."

*IG:whis.sama_ent*

Give 3 uses of the supermarket. ( each one of the uses has to have a sentence)

Answers

Answer:

1,a supermarket is a place where people buy and sell

Explanation:

is a small market where will have sellers and the buyer which are the consumer

Which group do you think the author intends readers to interpret as being "the wretched" and "the beautiful": the humans, the first set of aliens, or the second set of aliens?

The story is the wretched and beautiful

Answers

The first group of aliens—the humans—are the ones I believe the author wants readers to identify as "the wretched" and "the beautiful."

The initial group of aliens, the second group of aliens, or the humans?

E. Lily Yu explores human decisions in "The Wretched and the Beautiful," which presents human reactions to aliens who are both different from and similar to us. The aliens stand for anyone we perceive to be different from ourselves and represent any characteristic that society may use to criticize one another, such as race or age. The aliens are members of a different race that have come from a far-off planet in a distant galaxy. These aliens play a crucial role in the narrative.

To know more about "the beautiful" visit:

https://brainly.com/question/28887161

#SPJ1

What is the result of the military action from scene two

act five scene three Julius caesar

Answers

Answer:

Act 5, scene 2 Brutus sends Messala to throw all Brutus's legions into the battle. Act 5, scene 3 Cassius, mistakenly believing that the battle has been lost and that Titinius has been taken captive, orders Pindarus to kill him. When Titinius returns, he puts his wreath of victory on Cassius's head and kills himself.

Explanation:

if it helped u please mark me a brainliest :))

Answer:

Explanation:

Brutus and Cassius escape as Antony joins forces with Octavius Caesar. Encamped with their armies, Brutus and Cassius quarrel, then agree to march on Antony and Octavius. In the battle which follows, Cassius, misled by erroneous reports of loss, persuades a slave to kill him; Brutus's army is defeated.

Which statement best explains why the discussion about president Keith in the opening scene is important to the success of the story’s plot?

Answers

The reader should become familiar with it before becoming knowledgeable about time travel since it drives the plot along.

Communication strategy.

The conversation provides details about the political environment, the relationships between the individuals, and their perspectives on the President—all of which will be crucial as the novel develops.

Additionally, the opening scene contributes to setting the tone and atmosphere of the novel by letting the reader know what to anticipate in terms of the themes and the unfolding events. The opening scene sets the stage in such a way that it draws the reader in and establishes the framework for the remainder of the story.

To know more about plot visit:

https://brainly.com/question/30501122

#SPJ1

Which statement best explains why the discussion about president Keith in the opening scene is important to the success of the story’s plot?

history of internet (for my essay lang po hehe)

Answers

Answer:THE ORIGINS OF THE INTERNET

The origins of the internet are rooted in the USA of the 1950s. The Cold War was at its height and huge tensions existed between North America and the Soviet Union. Both superpowers were in possession of deadly nuclear weapons, and people lived in fear of long-range surprise attacks. The US realised it needed a communications system that could not be affected by a Soviet nuclear attack.

At this time, computers were large, expensive machines exclusively used by military scientists and university staff.

                                                                                                                           WHO INVENTED THE INTERNET?  

No one person invented the internet. When networking technology was first developed, a number of scientists and engineers brought their research together to create the ARPANET. Later, other inventors’ creations paved the way for the web as we know it today.  

what purpose does the mac serve during the change cipher spec ssl exchange?

Answers

During the Change Cipher Spec SSL exchange, the MAC (Message Authentication Code) serves the purpose of providing message integrity and authenticity.

It is a cryptographic hash function that is applied to the SSL handshake messages exchanged between the client and the server. The MAC ensures that any unauthorized modification of the messages is detected and rejected, preventing any tampering or interception of the SSL communication.

The Cipher Spec, on the other hand, specifies the encryption algorithm and other security parameters that will be used for the SSL session. Together, the MAC and Cipher Spec ensure a secure and reliable SSL exchange.

To know more about MAC visit:

https://brainly.com/question/28235724

#SPJ11

Read the following passage and answer the question.

We passed the School, where Children strove

10 At Recess—in the Ring—

We passed the Fields of Gazing Grain—

We passed the Setting Sun—
What do the school children symbolize?

youth
education
middle age
death

Answers

I think the answer is youth

Answer:

youth.

Explanation:

The school children in the passage symbolize youth.

The speaker observes the children playing during recess, which is a common activity for young students. The use of the word "Children" in capital letters suggests that the speaker is emphasizing their youthfulness and innocence. Additionally, the contrast between the school children and the later reference to the "Setting Sun" suggests a contrast between youth and the approach of old age or death. Therefore, the presence of the school children in the passage reinforces the theme of the passage as a celebration of youth and the beauty of the natural world.

debate on rainy season is more preferable to dry season rhetorical question ​

Answers

Answer:

Explanation:

Is rainy season really more preferable to dry season? While some may argue that the rainy season brings much-needed relief from the scorching heat and helps nourish crops and vegetation, others may say that it brings about flooding, water-borne diseases, and disruption to daily life. On the other hand, the dry season brings sunshine and clear skies, making it ideal for outdoor activities and travel, but it also brings about drought and water scarcity. So, which season is really more preferable? The answer may vary depending on one's personal preferences and needs.

PLS MARK ME BRAINLIEST

Service delivery in developed countries compared to service delivery in developing countries

Answers

There is a significant difference in service delivery between developed and developing countries,Developed countries generally have more advanced and efficient service delivery systems compared to developing countries.

This is due to factors such as higher levels of education, better infrastructure, and greater financial resources.  They also have more efficient and reliable systems for delivering these services, such as digital platforms and advanced technologies.

In contrast, developing countries often struggle with providing basic services to their citizens due to limited resources and infrastructure, as well as political and economic instability. They often lack the necessary resources to invest in advanced technology and infrastructure, which can hinder their ability to deliver services effectively. This can lead to unequal access to services, low quality services, and inefficient delivery systems.

To know more about developing countries, click here.

https://brainly.com/question/28741145

#SPJ1

Starfall: Learn to Re......
ectives and Adverbs
Question Yes GIF b. HYear 2011 Fun Fact... G Image result for ch. C Clever Applications S
Part 1
Part 2
Show It Try It
Part 3
Apply It
Determine whether the underlined word is an adverb, and identify the type of
"Check Answers" to see how well you did.
1. The Irish Festival is extremely popular. Select Answerttupeie tree orris

Answers

Yes, the word "extremely" is an adverb modifying the adjective "popular". It is an adverb of degree or intensity.

How is extremely an example of adverb?

"Extremely" is an adverb that modifies or describes the intensity or degree of an adjective, verb, or other adverb. It is used to provide emphasis or amplify the meaning of the word or phrase it modifies.

For example, in the sentence "The weather is extremely hot," the adverb "extremely" is used to modify the adjective "hot," indicating that the temperature is significantly higher than usual. Without the adverb "extremely," the sentence would simply state "The weather is hot," but the addition of "extremely" enhances the intensity of the adjective and conveys a stronger impression of the extreme heat.

Read more about adverb

brainly.com/question/912194

#SPJ1

What strange thing does Torvald tell Nora to express his love?

Answers

In Henrik Ibsen's play "A Doll's House," Torvald expresses his love for Nora in a strange and unconventional manner. Instead of displaying affection through traditional means, Torvald often infantilizes and belittles Nora, referring to her as his "little squirrel" or "little bird."

This unusual way of expressing love stems from the societal norms of their time, where women were expected to be submissive and dependent on their husbands.
Torvald's treatment of Nora reveals the power imbalance within their relationship, which Ibsen uses to critique the oppressive nature of 19th-century marriage dynamics. Although Torvald claims to love Nora, his actions suggest that he views her more as a possession or a plaything than an equal partner. This strange method of expressing love ultimately drives Nora to reevaluate her self-worth and question the true nature of their relationship, leading to a dramatic conclusion in the play.

To know more about societal norms:

https://brainly.com/question/31139379

#SPJ11

The Greatest Showman Question sheet
Please answer the following questions. (in photo)​

Answers

1. Younger
2. No
3. Tom Thumb
4. Owner of Barnums American Museum
5. 60
6. Four years old.
7. Yes
8.Four fires.
9. No
10. Two
11. Swedish
12. P.T. Promised her a great deal of money.
13. Because of his relentless marketing of her.
14. James A. Bailey
15. No

Help me please need the answer asap

Answers

Answer: I think wether or wether not Hamlet was good or bad is a tricky question. Someone could be bad but do good stuff but does that necessarily make them good?? Or vice versa. So now the actual question  did Hamlet deserve these kind and heroic words? I believe so, he was a good man who had a goal which albeit did involve bloodshed. He rightfully so wanted to avenge his father's death which doesn't make him more or less noble. I think he went to heaven and succeeded his goals.  

Select the correct answer.
Which phrase in paragraph 11 serves as the best context clue to the meaning of the word simulator?

A.
had a lower core temperature
B.
made fewer mistakes behind the wheel
C.
while they drove virtual laps
D.
a faster, more consistent lap time

Answers

The phrase "while they drove virtual laps" in paragraph 11 serves as the best context clue to the meaning of the word simulator. Therefore, the correct answer is C.

Answer: Should be A. had a lower core temperature

Explanation:

Select the correct answer from each drop-down menu.
How does the author develop the story's theme from the beginning to the end of the passage?
The author introduces the theme when she describes how Yen takes the coins, shapes the theme with Yen's reaction
to
J. and refines the theme with Yen's
Reset
Next

Answers

The author developed the story's theme by illustrating the culture clash between the Spring Frangrances' Chinese customs and their adopted country.

What is the theme?

It is a lesson that the author is imparting to the reader. The text in the question above demonstrates how many works of literature depict the struggles, triumphs, and day-to-day experiences of authors and characters from various ethnic groups. This kind of mentality highlights how crucial ethnic diversity is in writing and may impart a lot of knowledge to readers.

In conclusion, the author developed the story's theme by illustrating the culture clash between the Spring Frangrances' Chinese customs and their adopted country.

Learn more about theme on

https://brainly.com/question/28826222

#SPJ1

Please help it’s due tomorrow

Answers

Antonio conveyed to his companion (whether friend or servant) that all his currency is locked in vessels out at sea, ergo there was no accessible cash to present.

How to explain the information

Consequently, he proposed they travel to Venice and seek a loan on his credibility, even if it'd stretch his capability to the furthest extent.

This entailed from William Shakespeare's stage show "The Merchant of Venice", directly preceding this scene Antonio had consented to advance funds for Bassanio to woo and marry the affluent Portia. Contrarily, Antonio didn't have any liquid sources since his ships were off the coast, leading him disclose that raising support based on his reputation in Venice since seemed more hopeful.

Learn more about Shakespeare on

https://brainly.com/question/7592021

#SPJ1

What is the meaning of the visual image when Queen Shuri's mother leaps off the mountain?

Answers

The visual image you are referring to is from the movie "Black Panther" and depicts Queen Ramonda, the mother of Shuri, the princess of Wakanda, leaping off a cliff in order to escape from the clutches of the villainous Erik Killmonger.

How to explain the information

The phrase "Wakanda Forever" is a rallying cry and a symbol of unity for the people of Wakanda. It represents the pride and loyalty that the Wakandans have for their country, its traditions, and its people. When Queen Ramonda jumps off the mountain, she shouts "Wakanda Forever" as a symbol of her commitment to her homeland and her people, even in the face of danger.

The scene can be interpreted as a testament to the strength and courage of the Wakandan people, who are willing to make great sacrifices for the good of their country. It also serves as a reminder that Wakanda is more than just a physical place; it is a powerful symbol of hope and resilience for people around the world.

Learn more about mountain on

https://brainly.com/question/120431

#SPJ1

which model of communications theory states that a receiver gets a message from a sender? transmission model perceptual communication model visual communication model sensory communication model

Answers

The model of communications theory that states that a receiver gets a message from a sender is the transmission model.

This model is also known as the sender-receiver model, which includes elements such as the sender, message, channel, receiver, and feedback. This model provides a detailed explanation of how information or messages are transmitted from the sender to the receiver through a medium or channel, such as speech, text, or images. The transmission model emphasizes the importance of encoding, decoding, and feedback in effective communication.

In this model, the sender initiates the communication process by encoding the message, which is then transmitted through a channel to the receiver, who decodes the message and provides feedback to the sender.


To know more about Transmission model, click here:

https://brainly.com/question/8386534

#SPJ11

Insert a colon where necessary. If the sentence is correct, write C in the blank.

26. A song on the radio contained this clever line "Stale conversation deserves but a bread knife."

27. The older I get, the more I agree with the following quotation from Oscar Wilde "Youth is wasted on the young."

28. The first five states to ratify the United States Constitution were as follows Delaware, Pennsylvania, New Jersey, Georgia, and Connecticut.

29. The following items can be obtained from the storage room an old bike, a tennis racquet, and a painting.

30. These are the main characters in Lord of the Flies Ralph, Jack, and Piggy.

31. My mind is made up I will search for a new summer job instead of working at the supermarket again.

32. Her expression was difficult to interpret the smile on her mouth could have been a grin or a grimace.

Answers

26. A song on the radio contained this clever line: "Stale conversation deserves but a bread knife."
27. The older I get, the more I agree with the following quotation from Oscar Wilde: "Youth is wasted on the young."
28. The first five states to ratify the United States Constitution were as follows: Delaware, Pennsylvania, New Jersey, Georgia, and Connecticut.
29. The following items can be obtained from the storage room: an old bike, a tennis racquet, and a painting.
30. These are the main characters in Lord of the Flies: Ralph, Jack, and Piggy.
31. My mind is made up: I will search for a new summer job instead of working at the supermarket again.
32. Her expression was difficult to interpret: the smile on her mouth could have been a grin or a grimace.

Use this passage to answer the following question.
The dog ran outside all happy and carefree. [1]
He held his head as high as the clouds. [2]
The dog did not look as he ran into a tree. [3]
He became glue watching the ground. [4]
Complete the sentence.
The phrase "as high as the clouds" is an example of a(n)

Answers

Answer: simile, which is a figure of speech that makes a comparison between two things using the words "like" or "as."

Explanation:

Use the Hints on this page to help you answer the questions.
1 Reread the second sentence in paragraph 1. What effect do the word
choices have on the meaning and tone of this paragraph?
A
B
C
D
The phrase charged into has negative connotations and suggests
that the Forty-Niners were reckless and angry.
The terms charged and ballooning convey the idea of sudden and
dramatic movement or growth.
The use of ballooning gives the idea that the growth was somehow
fragile and prone to "break" suddenly or easily.
The word unprecedented conveys the author's attitude that this
event is not well understood.

Answers

Note tht the effect of the word choices on the meaning and tone of the paragraph is: "The terms "charged" and "ballooning" convey the idea of sudden and dramatic movement or growth." (Option B)

what is tone?

Tone refers to the feelings expressed by  the author of the text. It conveys the emotions behind the words nd helps to put the literature in emotional context.

Tone can be negative, positive, excited, sorrowful etc.

Thus, it is correct to state that  the effect of the word choices on the meaning and tone of the paragraph is: "The terms "charged" and "ballooning" convey the idea of sudden and dramatic movement or growth." (Otion B)

Learn more about tone at:

https://brainly.com/question/1416982

#SPJ1

Full Question:

Although part of your question is missing, you might be referring to this full question:

Reread the second sentence of paragraph 1 of "The Trans-Pacific Passage Toward the Gold Fields." What effect do the word choices have on the meaning and tone of this paragraph?

The phrase "charged into" has negative connotations and suggests that the Forty-Niners were reckless and angry.

The terms "charged" and "ballooning" convey the idea of sudden and dramatic movement or growth.

The use of "ballooning" gives the idea that the growth was somehow fragile and prone to "break" suddenly or easily.

The word "unprecedented" conveys the author's attitude that this event is not well understood.

T or F. When giving a persuasive speech the general purpose is to inform.

Answers

Answer:

True

Explanation:

When giving a persuasive speech, you are informing them about something which you are trying to persuade. (My wording might be a bit messed up but the answer is true)

kathy is creating __ detailing visual information about an application system, how it works, and how to use it.A. An installation document
B. A design document
C. User documentation
D. System documentation

Answers

Answer:

Kathy is creating a system documentation detailing visual information about an application system, how it works and how to use it.

Kathy is creating User Documentation detailing visual information about an application system, how it works, and how to use it.


User Documentation provides a proper explanation to guide end-users in utilizing an application system. This documentation typically includes step-by-step instructions, illustrations, and troubleshooting information to help users navigate the system effectively. User documentation also provides a proper explanation of how an application system works and how to use it, often with the aid of visual information.

It is intended to help users understand and use the application effectively.

To know more about User Documentation, click here:

https://brainly.com/question/17349302

#SPJ11

What does Torvald think of Dr. Rank when he comes late at night?

Answers

In Henrik Ibsen's play "A Doll's House," Torvald Helmer, the protagonist, does not have a favorable opinion of his friend and confidant Dr. Rank when he arrives late at night.

Torvald considers Dr. Rank to be a constant reminder of his own mortality and moral failings, as Dr. Rank is terminally ill and has a reputation as a womanizer. Torvald also worries that Dr. Rank's presence may compromise his own social standing and reputation. Torvald's negative attitude towards Dr. Rank reflects the social norms of the time period, where illness and immorality were often seen as shameful and disgraceful. Despite this, Dr. Rank's character serves as a catalyst for the play's exploration of societal expectations and the roles of men and women in marriage and society.

To know more about the protagonist:

https://brainly.com/question/1465444

#SPJ11

Other Questions
A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states? calculate the change in entropy for the vaporization of xe at its boiling point of -107 c given that vaph = 12.6 kj/mol. 1. -0.118 j/k mol 2. -13.2 j/k mol 3. 0.750 j/k mol 4. 75.9 j/k mol FeatureThe Ethanol DebateNatalie StewartOur society has recently undergone a shift towards greener living. People have grown more aware of how their actions seriously and negatively impact the environment. Many are seeking out new ways to decrease pollution levels and to find cleaner energy sources to power their homes and businesses. Ethanol is an increasingly popular fuel alternative to gasoline, made from distilled, fermented corn. The benefits of ethanol include lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline, as well as decreasing the United States dependence on foreign oil. Though many people support the production of ethanol for use as an alternative fuel, most of them ignore the serious drawbacks of ethanol use.One important economic factor in producing ethanol is its influence on the price of corn. Corn prices have more than doubled since 2005 because of increased demand, according to financial experts. Farmers know that corn is highly sought after, so they allot more space on their farms to grow large amounts of corn. This leaves less room for growing other kinds of crops, such as wheat or soybeans. These smaller amounts force suppliers to raise the prices of these now secondary crops as well. Bread and cereal manufactures are also involved in the economics of ethanol. These companies then pass rising costs of their crops to consumers, leading to higher prices at the grocery store.Corn is also a common source of food for livestock. Many farmers are now struggling to feed their herds of cows, chickens, and pigs. The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers. Shoppers are certain to see the prices of beef, chicken, and pork increase if corn prices continue to skyrocket. Unfortunately, hardworking farmers and ranchers see very little profits from this increase in price. Many of them oppose ethanol as an alternative fuel source because of the extreme impact it is having on their way of life.In addition, opponents of ethanol note that government subsidies cost American taxpayers more money. State and federal government subsidy programs offer tax credits to gas stations for each gallon of ethanol they mix in with the gasoline they sell. Government programs also supply companies that produce ethanol with corn! Where does the government get the money for these subsidies? Money for these projects comes from ourthe taxpayerspockets. These costs are in addition to rising fuel prices, which are currently almost four dollars per gallon. Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Overall, it would be more cost-effective for everyone if the government pursued other options for fuel and energy sources.Ethanol has some benefits. However, overenthusiastic supporters should consider all sides of the issue before taking actions that are already putting Americas economy in a precarious position. Ethanol is not the answer to our economic and environmental problems. Instead of focusing on a technology that is too costly to be practical, we should be encouraging our government to continue investing in other alternatives. Only then will we see our food and energy prices stabilize. Which two pieces of evidence from the passage support the author's point of view as identified in the previous question?ResponsesA The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.B People have grown more aware of how their actions seriously and negatively impact the environment.People have grown more aware of how their actions seriously and negatively impact the environment.C Another benefit of ethanol is decreasing the United States dependence on foreign oil.Another benefit of ethanol is decreasing the United States dependence on foreign oil.D One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.E Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Please answer question #35 According to Thomson Financial, last year the majority of companies reporting profits had beaten estimates. A sample of 162 companies showed that 94 beat estimates, 29 matched estimates, and 39 fell short.(a) What is the point estimate of the proportion that fell short of estimates? If required, round your answer to four decimal places.pshort = .2407(b) Determine the margin of error and provide a 95% confidence interval for the proportion that beat estimates. If required, round your answer to four decimal places.ME = (c) How large a sample is needed if the desired margin of error is 0.05? If required, round your answer to the next integer.n* = Discussion What part of the life cycle is represented by the mature pollen grain int[] oldArray = {1, 2, 3, 4, 5, 6, 7, 8, 9}; int[newArray = new int[3][3]; int row = 0; int col = 0; for (int index = 0; index < oldArray.length; index++) { newArray[row][col] = oldArray[index]; row++; if ((row % 3) == 0) { col++; row = 0; } } System.out.println(newArray[0][2]); What is printed as a result of executing the code segment? Determine if each of the following relationships represents a proportional relationship or not.SELECT ALL situations that represent a proportional relationship.A). Natalia is selling fresh eggs at the local farmer's market. She sells 6 eggs for $3.12, a dozen eggs for $6.24, and eighteen eggs for $9.36.B). Joey is training for a bicycle race and has been completing his longer training rides on Saturdays. Over the past month, Joey has ridden his bicycle 36 miles in 3 hours, 46 miles in 4 hours, and 22 miles in 2 hours.C). graph 1 provided in the picturesD). graph 2 provided in the picturesE). Azul bought several different packages of 8-inch by 10-inch art canvases for craft project at her family reunion. The number of canvases in a package and the cost of the package is shown in the table. (TABLE PROVIDED IN PICTURES)F). Kareem is comparing the cost of regular unleaded gasoline at three different gas stations near his home. Instead of filling up his car's gas tank at one station, he puts a few gallons in at each of the three different stations. The number of gallons of gasoline and the cost of the gasoline is shown in the table. (TABLE PROVIDED IN PICTURES) In the financial statements, dividends in arrears on cumulative preferred stock should be _____Select one: a classified as an offset to retained earnings b. classified as a liability either current or long term.C. disclosed in the footnotes. d. classified as an offset to net income f q1 has the same magnitude as before but is negative, in what region along the x-axis would it be possible for the net electric force on q3 to be zero? (a) x , 0 (b) 0 , x , 2 m (c) 2 m , x